EMAIL THIS PAGE TO A FRIEND

THAP9

THAP domain containing 9

Synonyms: hTh9
UniProtKB ID: Q9H5L6, B3KRE2, Q59AC9
Gene ID:
cow(508288) THAP domain containing 9
sheep(101116480) THAP domain containing 9
naked mole-rat(101717530) THAP domain containing 9
domestic guinea pig(100730580) THAP domain containing 9
chicken(422596) THAP domain containing 9
domestic cat(101086224) THAP domain containing 9
dog(487834) THAP domain containing 9
Horse(100052075) THAP domain containing 9
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024672 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010151 MISSION® esiRNA esiRNA targeting human THAP9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024672 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042692 predicted 1968
2 SASI_Hs01_00042694 predicted 2163
3 SASI_Hs02_00357092 predicted 1404
4 SASI_Hs01_00042696 predicted 705
5 SASI_Hs01_00042697 predicted 484
6 SASI_Hs01_00042699 predicted 386
7 SASI_Hs02_00357093 predicted 1353
8 SASI_Hs01_00042700 predicted 2790
9 SASI_Hs01_00042701 predicted 1981
10 SASI_Hs02_00357094 predicted 964
11 SASI_Hs01_00042693 predicted 780
12 SASI_Hs01_00042695 predicted 1335
13 SASI_Hs01_00042698 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024672
VALIDATED
THAP9 MISSION shRNA Bacterial Glycerol Stock
THAP domain containing 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-533s1c1
Sequence:CCGGGATCAAGAAGAGAAAGGGTTTCTCGAGAAACCCTTTCTCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-2380s1c1
Sequence:CCGGGAGTTGTAAGAACCCATTCAACTCGAGTTGAATGGGTTCTTACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-387s1c1
Sequence:CCGGCCAGACAATTCTCAAGAAGTTCTCGAGAACTTCTTGAGAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024672.2-3026s1c1
Sequence:CCGGCTGTAAGACTAAGCAGTGTTACTCGAGTAACACTGCTTAGTCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-539s1c1
Sequence:CCGGGAAGAGAAAGGGTTTACGATTCTCGAGAATCGTAAACCCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-705s1c1
Sequence:CCGGCTCTACTTGTGCAGTAGCAAACTCGAGTTTGCTACTGCACAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024672.2-2997s1c1
Sequence:CCGGGCCAACAGGTACTGTCTTTGACTCGAGTCAAAGACAGTACCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-1109s1c1
Sequence:CCGGGCTTCGTCTGACTATTGGTAACTCGAGTTACCAATAGTCAGACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024672.2-305s1c1
Sequence:CCGGGCCTTCTGTTTCTCTATACAACTCGAGTTGTATAGAGAAACAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-2217s1c1
Sequence:CCGGGCAAACAAGTTATCAGCTCTTCTCGAGAAGAGCTGATAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024672
VALIDATED
THAP9 MISSION shRNA shRNA Plasmid DNA
THAP domain containing 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-533s1c1
Sequence:CCGGGATCAAGAAGAGAAAGGGTTTCTCGAGAAACCCTTTCTCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-2380s1c1
Sequence:CCGGGAGTTGTAAGAACCCATTCAACTCGAGTTGAATGGGTTCTTACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-387s1c1
Sequence:CCGGCCAGACAATTCTCAAGAAGTTCTCGAGAACTTCTTGAGAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024672.2-3026s1c1
Sequence:CCGGCTGTAAGACTAAGCAGTGTTACTCGAGTAACACTGCTTAGTCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-539s1c1
Sequence:CCGGGAAGAGAAAGGGTTTACGATTCTCGAGAATCGTAAACCCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-705s1c1
Sequence:CCGGCTCTACTTGTGCAGTAGCAAACTCGAGTTTGCTACTGCACAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024672.2-2997s1c1
Sequence:CCGGGCCAACAGGTACTGTCTTTGACTCGAGTCAAAGACAGTACCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-1109s1c1
Sequence:CCGGGCTTCGTCTGACTATTGGTAACTCGAGTTACCAATAGTCAGACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024672.2-305s1c1
Sequence:CCGGGCCTTCTGTTTCTCTATACAACTCGAGTTGTATAGAGAAACAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-2217s1c1
Sequence:CCGGGCAAACAAGTTATCAGCTCTTCTCGAGAAGAGCTGATAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024672
VALIDATED
THAP9 MISSION shRNA Lentiviral Transduction Particles
THAP domain containing 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-533s1c1
Sequence:CCGGGATCAAGAAGAGAAAGGGTTTCTCGAGAAACCCTTTCTCTTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-2380s1c1
Sequence:CCGGGAGTTGTAAGAACCCATTCAACTCGAGTTGAATGGGTTCTTACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-387s1c1
Sequence:CCGGCCAGACAATTCTCAAGAAGTTCTCGAGAACTTCTTGAGAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024672.2-3026s1c1
Sequence:CCGGCTGTAAGACTAAGCAGTGTTACTCGAGTAACACTGCTTAGTCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-539s1c1
Sequence:CCGGGAAGAGAAAGGGTTTACGATTCTCGAGAATCGTAAACCCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024672.2-705s1c1
Sequence:CCGGCTCTACTTGTGCAGTAGCAAACTCGAGTTTGCTACTGCACAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024672.2-2997s1c1
Sequence:CCGGGCCAACAGGTACTGTCTTTGACTCGAGTCAAAGACAGTACCTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-1109s1c1
Sequence:CCGGGCTTCGTCTGACTATTGGTAACTCGAGTTACCAATAGTCAGACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024672.2-305s1c1
Sequence:CCGGGCCTTCTGTTTCTCTATACAACTCGAGTTGTATAGAGAAACAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024672.2-2217s1c1
Sequence:CCGGGCAAACAAGTTATCAGCTCTTCTCGAGAAGAGCTGATAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks