EMAIL THIS PAGE TO A FRIEND

THBD

thrombomodulin

Synonyms: AHUS6 BDCA3 CD141 THPH12 THRM TM
UniProtKB ID: P07204, Q8IV29, Q9UC32
Gene ID:
Human(7056) Summary: The protein encoded by this intronless gene is an endothelial-specific type I membrane receptor that binds thrombin. This binding results in the activation of protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated. Mutations in this gene are a cause of thromboembolic disease, also known as inherited thrombophilia. [provided by RefSeq, Jul 2008]
Mouse(21824) thrombomodulin
Rat(83580) thrombomodulin
chicken(428546) thrombomodulin
chicken(101752029) thrombomodulin
dog(474355) thrombomodulin
domestic cat(100049012) thrombomodulin
chicken(101666591) thrombomodulin
naked mole-rat(101700359) thrombomodulin
cow(281529) thrombomodulin
sheep(101103256) thrombomodulin
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0739 Human THBD / Thrombomodulin ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000361 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000361 Rosetta Predictions human pricing
NM_031771 Rosetta Predictions rat pricing
NM_009378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038623 predicted 1476
2 SASI_Hs01_00038625 predicted 490
3 SASI_Hs01_00038626 predicted 1432
4 SASI_Hs01_00038627 predicted 479
5 SASI_Hs01_00038628 predicted 1016
6 SASI_Hs01_00038629 predicted 1266
7 SASI_Hs01_00038630 predicted 479
8 SASI_Hs01_00038631 predicted 1871
9 SASI_Hs02_00302410 predicted 288
10 SASI_Hs01_00038632 predicted 1948
11 SASI_Hs01_00038624 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036953 predicted 1180
2 SASI_Rn01_00036954 predicted 1284
3 SASI_Rn01_00036956 predicted 1355
4 SASI_Rn01_00036957 predicted 1806
5 SASI_Rn01_00036958 predicted 241
6 SASI_Rn01_00036959 predicted 1867
7 SASI_Rn02_00265205 predicted 873
8 SASI_Rn01_00036960 predicted 996
9 SASI_Rn01_00036961 predicted 854
10 SASI_Rn01_00036962 predicted 1040
11 SASI_Rn01_00036955 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049870 predicted 1188
2 SASI_Mm01_00049871 predicted 236
3 SASI_Mm01_00049872 predicted 488
4 SASI_Mm01_00049873 predicted 1060
5 SASI_Mm01_00049874 predicted 1360
6 SASI_Mm01_00049875 predicted 998
7 SASI_Mm01_00049876 predicted 1400
8 SASI_Mm01_00049878 predicted 1489
9 SASI_Mm01_00049879 predicted 919
10 SASI_Mm02_00315988 predicted 1265
11 SASI_Mm01_00049877 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009378
VALIDATED
THBD MISSION shRNA Bacterial Glycerol Stock
thrombomodulin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009378.1-2009s1c1
Sequence:CCGGGCTGGTATAATAACCAGAGAACTCGAGTTCTCTGGTTATTATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009378.1-1508s1c1
Sequence:CCGGCACCAGTGAATGTCGAAACTTCTCGAGAAGTTTCGACATTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-476s1c1
Sequence:CCGGCCAGTGGGTTACTGGCGATAACTCGAGTTATCGCCAGTAACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-713s1c1
Sequence:CCGGTGCCCACATCTCTAGTACCTACTCGAGTAGGTACTAGAGATGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-716s1c1
Sequence:CCGGCCACATCTCTAGTACCTACAACTCGAGTTGTAGGTACTAGAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009378.3-1103s21c1
Sequence:CCGGCAACGAACTCTGCGAGCATTTCTCGAGAAATGCTCGCAGAGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009378.3-2304s21c1
Sequence:CCGGCTGGAGATGACCCAGATATTTCTCGAGAAATATCTGGGTCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-1436s21c1
Sequence:CCGGTGAACCGCACAAGTGCGAAATCTCGAGATTTCGCACTTGTGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-1348s21c1
Sequence:CCGGTCGGATCTAACTGCGAGTTTCCTCGAGGAAACTCGCAGTTAGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-486s21c1
Sequence:CCGGTTAGGGCCCTGGATCGGTTTACTCGAGTAAACCGATCCAGGGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009378
VALIDATED
THBD MISSION shRNA shRNA Plasmid DNA
thrombomodulin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009378.1-2009s1c1
Sequence:CCGGGCTGGTATAATAACCAGAGAACTCGAGTTCTCTGGTTATTATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009378.1-1508s1c1
Sequence:CCGGCACCAGTGAATGTCGAAACTTCTCGAGAAGTTTCGACATTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-476s1c1
Sequence:CCGGCCAGTGGGTTACTGGCGATAACTCGAGTTATCGCCAGTAACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-713s1c1
Sequence:CCGGTGCCCACATCTCTAGTACCTACTCGAGTAGGTACTAGAGATGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-716s1c1
Sequence:CCGGCCACATCTCTAGTACCTACAACTCGAGTTGTAGGTACTAGAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009378.3-1103s21c1
Sequence:CCGGCAACGAACTCTGCGAGCATTTCTCGAGAAATGCTCGCAGAGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009378.3-2304s21c1
Sequence:CCGGCTGGAGATGACCCAGATATTTCTCGAGAAATATCTGGGTCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-1436s21c1
Sequence:CCGGTGAACCGCACAAGTGCGAAATCTCGAGATTTCGCACTTGTGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-1348s21c1
Sequence:CCGGTCGGATCTAACTGCGAGTTTCCTCGAGGAAACTCGCAGTTAGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-486s21c1
Sequence:CCGGTTAGGGCCCTGGATCGGTTTACTCGAGTAAACCGATCCAGGGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009378
VALIDATED
THBD MISSION shRNA Lentiviral Transduction Particles
thrombomodulin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009378.1-2009s1c1
Sequence:CCGGGCTGGTATAATAACCAGAGAACTCGAGTTCTCTGGTTATTATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009378.1-1508s1c1
Sequence:CCGGCACCAGTGAATGTCGAAACTTCTCGAGAAGTTTCGACATTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-476s1c1
Sequence:CCGGCCAGTGGGTTACTGGCGATAACTCGAGTTATCGCCAGTAACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-713s1c1
Sequence:CCGGTGCCCACATCTCTAGTACCTACTCGAGTAGGTACTAGAGATGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009378.1-716s1c1
Sequence:CCGGCCACATCTCTAGTACCTACAACTCGAGTTGTAGGTACTAGAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009378.3-1103s21c1
Sequence:CCGGCAACGAACTCTGCGAGCATTTCTCGAGAAATGCTCGCAGAGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009378.3-2304s21c1
Sequence:CCGGCTGGAGATGACCCAGATATTTCTCGAGAAATATCTGGGTCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-1436s21c1
Sequence:CCGGTGAACCGCACAAGTGCGAAATCTCGAGATTTCGCACTTGTGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-1348s21c1
Sequence:CCGGTCGGATCTAACTGCGAGTTTCCTCGAGGAAACTCGCAGTTAGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009378.3-486s21c1
Sequence:CCGGTTAGGGCCCTGGATCGGTTTACTCGAGTAAACCGATCCAGGGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000361
THBD MISSION shRNA Bacterial Glycerol Stock
thrombomodulin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-362s1c1
Sequence:CCGGGCCGATGTCATTTCCTTGCTACTCGAGTAGCAAGGAAATGACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1708s1c1
Sequence:CCGGCTTGCTCATAGGCATCTCCATCTCGAGATGGAGATGCCTATGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-484s1c1
Sequence:CCGGCCAGTGGGTTACGGGAGACAACTCGAGTTGTCTCCCGTAACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-292s1c1
Sequence:CCGGCTTCCTCAATGCCAGTCAGATCTCGAGATCTGACTGGCATTGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1427s1c1
Sequence:CCGGGCTAGCTGTGAGTGCCCTGAACTCGAGTTCAGGGCACTCACAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1427s1c2
Sequence:CCGGGCTAGCTGTGAGTGCCCTGAACTCGAGTTCAGGGCACTCACAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000361
THBD MISSION shRNA shRNA Plasmid DNA
thrombomodulin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-362s1c1
Sequence:CCGGGCCGATGTCATTTCCTTGCTACTCGAGTAGCAAGGAAATGACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1708s1c1
Sequence:CCGGCTTGCTCATAGGCATCTCCATCTCGAGATGGAGATGCCTATGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-484s1c1
Sequence:CCGGCCAGTGGGTTACGGGAGACAACTCGAGTTGTCTCCCGTAACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-292s1c1
Sequence:CCGGCTTCCTCAATGCCAGTCAGATCTCGAGATCTGACTGGCATTGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1427s1c1
Sequence:CCGGGCTAGCTGTGAGTGCCCTGAACTCGAGTTCAGGGCACTCACAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1427s1c2
Sequence:CCGGGCTAGCTGTGAGTGCCCTGAACTCGAGTTCAGGGCACTCACAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000361
THBD MISSION shRNA Lentiviral Transduction Particles
thrombomodulin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-362s1c1
Sequence:CCGGGCCGATGTCATTTCCTTGCTACTCGAGTAGCAAGGAAATGACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1708s1c1
Sequence:CCGGCTTGCTCATAGGCATCTCCATCTCGAGATGGAGATGCCTATGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-484s1c1
Sequence:CCGGCCAGTGGGTTACGGGAGACAACTCGAGTTGTCTCCCGTAACCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-292s1c1
Sequence:CCGGCTTCCTCAATGCCAGTCAGATCTCGAGATCTGACTGGCATTGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1427s1c1
Sequence:CCGGGCTAGCTGTGAGTGCCCTGAACTCGAGTTCAGGGCACTCACAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000361.2-1427s1c2
Sequence:CCGGGCTAGCTGTGAGTGCCCTGAACTCGAGTTCAGGGCACTCACAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks