EMAIL THIS PAGE TO A FRIEND

THBS1

thrombospondin 1

Synonyms: THBS THBS-1 TSP TSP-1 TSP1
UniProtKB ID: P07996, A8K6H4, B9EGH6, Q15667
Gene ID:
Human(7057) Summary: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(21825) thrombospondin 1
Rat(445442) thrombospondin 1
cow(281530) thrombospondin 1
Goat(100860971) thrombospondin 1
sheep(101106433) thrombospondin 1
sheep(100294615) thrombospondin 1
Domestic Rabbit(100350430) thrombospondin 1
naked mole-rat(101701581) thrombospondin 1
Zebrafish(561901) thrombospondin 1
domestic cat(101092689) thrombospondin 1
Horse(100057478) thrombospondin 1
dog(487486) thrombospondin 1
chicken(373987) thrombospondin 1
191 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0387 AQUA Peptide FVFGTTPEDIL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003246 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003246 Rosetta Predictions human pricing
NM_001013062 Rosetta Predictions rat pricing
NM_011580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148022 predicted 3145
2 SASI_Hs01_00148023 predicted 3686
3 SASI_Hs02_00335285 predicted 3479
4 SASI_Hs02_00335286 predicted 2357
5 SASI_Hs01_00148026 predicted 3667
6 SASI_Hs01_00148027 predicted 2739
7 SASI_Hs01_00148028 predicted 941
8 SASI_Hs01_00148029 predicted 2688
9 SASI_Hs01_00148030 predicted 3597
10 SASI_Hs01_00148031 predicted 2571
11 SASI_Hs01_00148024 predicted 3112
12 SASI_Hs01_00148025 predicted 3105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119176 predicted 799
2 SASI_Rn01_00119177 predicted 2463
3 SASI_Rn01_00119178 predicted 1735
4 SASI_Rn02_00200680 predicted 2657
5 SASI_Rn01_00119181 predicted 3088
6 SASI_Rn01_00119182 predicted 2682
7 SASI_Rn01_00119183 predicted 822
8 SASI_Rn01_00119184 predicted 1612
9 SASI_Rn01_00119185 predicted 3491
10 SASI_Rn02_00200681 predicted 1818
11 SASI_Rn01_00119179 predicted 1949
12 SASI_Rn01_00119180 predicted 2623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156506 predicted 947
2 SASI_Mm01_00156508 predicted 3531
3 SASI_Mm01_00156511 predicted 3347
4 SASI_Mm01_00156512 predicted 1632
5 SASI_Mm01_00156513 predicted 1818
6 SASI_Mm01_00156514 predicted 2607
7 SASI_Mm01_00156515 predicted 1969
8 SASI_Mm02_00320971 predicted 2978
9 SASI_Mm02_00320972 predicted 1759
10 SASI_Mm02_00320973 predicted 2746
11 SASI_Mm01_00156507 predicted 3047
12 SASI_Mm01_00156509 predicted 975
13 SASI_Mm01_00156510 predicted 1896
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011580
VALIDATED
THBS1 MISSION shRNA Bacterial Glycerol Stock
thrombospondin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3044s21c1
Sequence:CCGGTGAAACCGATTTCCGACAATTCTCGAGAATTGTCGGAAATCGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3698s21c1
Sequence:CCGGATCATCAGCTGCCAATCATAACTCGAGTTATGATTGGCAGCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3487s21c1
Sequence:CCGGGCTGGAAAGATTTCACTGCATCTCGAGATGCAGTGAAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3959s21c1
Sequence:CCGGGCGCCTATTTACTTCCCACTACTCGAGTAGTGGGAAGTAAATAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3527s21c1
Sequence:CCGGCAGGCCAAAGACCGGTTATATCTCGAGATATAACCGGTCTTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3959s1c1
Sequence:CCGGGCGCCTATTTACTTCCCACTACTCGAGTAGTGGGAAGTAAATAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3539s1c1
Sequence:CCGGCGGTTATATCAGAGTGGTGATCTCGAGATCACCACTCTGATATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011580.2-2144s1c1
Sequence:CCGGGACGCATGACTGCAACAAGAACTCGAGTTCTTGTTGCAGTCATGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3487s1c1
Sequence:CCGGGCTGGAAAGATTTCACTGCATCTCGAGATGCAGTGAAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011580.2-2834s1c1
Sequence:CCGGCGACCATGATAAAGATGGCAACTCGAGTTGCCATCTTTATCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011580
VALIDATED
THBS1 MISSION shRNA shRNA Plasmid DNA
thrombospondin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3044s21c1
Sequence:CCGGTGAAACCGATTTCCGACAATTCTCGAGAATTGTCGGAAATCGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3698s21c1
Sequence:CCGGATCATCAGCTGCCAATCATAACTCGAGTTATGATTGGCAGCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3487s21c1
Sequence:CCGGGCTGGAAAGATTTCACTGCATCTCGAGATGCAGTGAAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3959s21c1
Sequence:CCGGGCGCCTATTTACTTCCCACTACTCGAGTAGTGGGAAGTAAATAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3527s21c1
Sequence:CCGGCAGGCCAAAGACCGGTTATATCTCGAGATATAACCGGTCTTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3959s1c1
Sequence:CCGGGCGCCTATTTACTTCCCACTACTCGAGTAGTGGGAAGTAAATAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3539s1c1
Sequence:CCGGCGGTTATATCAGAGTGGTGATCTCGAGATCACCACTCTGATATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011580.2-2144s1c1
Sequence:CCGGGACGCATGACTGCAACAAGAACTCGAGTTCTTGTTGCAGTCATGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3487s1c1
Sequence:CCGGGCTGGAAAGATTTCACTGCATCTCGAGATGCAGTGAAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011580.2-2834s1c1
Sequence:CCGGCGACCATGATAAAGATGGCAACTCGAGTTGCCATCTTTATCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011580
VALIDATED
THBS1 MISSION shRNA Lentiviral Transduction Particles
thrombospondin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3044s21c1
Sequence:CCGGTGAAACCGATTTCCGACAATTCTCGAGAATTGTCGGAAATCGGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3698s21c1
Sequence:CCGGATCATCAGCTGCCAATCATAACTCGAGTTATGATTGGCAGCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3487s21c1
Sequence:CCGGGCTGGAAAGATTTCACTGCATCTCGAGATGCAGTGAAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3959s21c1
Sequence:CCGGGCGCCTATTTACTTCCCACTACTCGAGTAGTGGGAAGTAAATAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011580.3-3527s21c1
Sequence:CCGGCAGGCCAAAGACCGGTTATATCTCGAGATATAACCGGTCTTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3959s1c1
Sequence:CCGGGCGCCTATTTACTTCCCACTACTCGAGTAGTGGGAAGTAAATAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3539s1c1
Sequence:CCGGCGGTTATATCAGAGTGGTGATCTCGAGATCACCACTCTGATATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011580.2-2144s1c1
Sequence:CCGGGACGCATGACTGCAACAAGAACTCGAGTTCTTGTTGCAGTCATGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011580.2-3487s1c1
Sequence:CCGGGCTGGAAAGATTTCACTGCATCTCGAGATGCAGTGAAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011580.2-2834s1c1
Sequence:CCGGCGACCATGATAAAGATGGCAACTCGAGTTGCCATCTTTATCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003246
VALIDATED
THBS1 MISSION shRNA Bacterial Glycerol Stock
thrombospondin 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003246.2-3682s21c1
Sequence:CCGGGAGATCCCTAATCATCAAATTCTCGAGAATTTGATGATTAGGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3902s21c1
Sequence:GTACCGGAGACATCTTCCAAGCATATAACTCGAGTTATATGCTTGGAAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3029s21c1
Sequence:CCGGTGACATCAGTGAGACCGATTTCTCGAGAAATCGGTCTCACTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003246.2-3226s21c1
Sequence:CCGGCCGAAAGGGACGATGACTATGCTCGAGCATAGTCATCGTCCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3171s21c1
Sequence:CCGGGTAGGTTATGATGAGTTTAATCTCGAGATTAAACTCATCATAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.2-3638s1c1
Sequence:CCGGCTCTCAAGAAATGGTGTTCTTCTCGAGAAGAACACCATTTCTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.2-3005s1c1
Sequence:CCGGCGATGACATCTGTCCTGAGAACTCGAGTTCTCAGGACAGATGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039693    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003246.2-5343s1c1
Sequence:CCGGATCATCTGGTATACCATTGCCCTCGAGGGCAATGGTATACCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-879s1c1
Sequence:CCGGTAACTACATTGGCCACAAGACCTCGAGGTCTTGTGGCCAATGTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-2293s1c1
Sequence:CCGGGACTATGACAAGGATGGAATTCTCGAGAATTCCATCCTTGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003246.x-1060s1c1
Sequence:CCGGCTATGCTATCACAACGGAGTTCTCGAGAACTCCGTTGTGATAGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-3593s1c1
Sequence:CCGGCTGACCTGAAATACGAATGTACTCGAGTACATTCGTATTTCAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003246.x-5343s1c1
Sequence:CCGGTATCATCTGGTATACCATTGCCTCGAGGCAATGGTATACCAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-3231s1c1
Sequence:CCGGAAGCAAGTCACCCAGTCCTACTCGAGTAGGACTGGGTGACTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003246
VALIDATED
THBS1 MISSION shRNA shRNA Plasmid DNA
thrombospondin 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003246.2-3682s21c1
Sequence:CCGGGAGATCCCTAATCATCAAATTCTCGAGAATTTGATGATTAGGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3902s21c1
Sequence:GTACCGGAGACATCTTCCAAGCATATAACTCGAGTTATATGCTTGGAAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3029s21c1
Sequence:CCGGTGACATCAGTGAGACCGATTTCTCGAGAAATCGGTCTCACTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003246.2-3226s21c1
Sequence:CCGGCCGAAAGGGACGATGACTATGCTCGAGCATAGTCATCGTCCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3171s21c1
Sequence:CCGGGTAGGTTATGATGAGTTTAATCTCGAGATTAAACTCATCATAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.2-3638s1c1
Sequence:CCGGCTCTCAAGAAATGGTGTTCTTCTCGAGAAGAACACCATTTCTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.2-3005s1c1
Sequence:CCGGCGATGACATCTGTCCTGAGAACTCGAGTTCTCAGGACAGATGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039693    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003246.2-5343s1c1
Sequence:CCGGATCATCTGGTATACCATTGCCCTCGAGGGCAATGGTATACCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-879s1c1
Sequence:CCGGTAACTACATTGGCCACAAGACCTCGAGGTCTTGTGGCCAATGTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-2293s1c1
Sequence:CCGGGACTATGACAAGGATGGAATTCTCGAGAATTCCATCCTTGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003246.x-1060s1c1
Sequence:CCGGCTATGCTATCACAACGGAGTTCTCGAGAACTCCGTTGTGATAGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-3593s1c1
Sequence:CCGGCTGACCTGAAATACGAATGTACTCGAGTACATTCGTATTTCAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003246.x-5343s1c1
Sequence:CCGGTATCATCTGGTATACCATTGCCTCGAGGCAATGGTATACCAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-3231s1c1
Sequence:CCGGAAGCAAGTCACCCAGTCCTACTCGAGTAGGACTGGGTGACTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003246
VALIDATED
THBS1 MISSION shRNA Lentiviral Transduction Particles
thrombospondin 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003246.2-3682s21c1
Sequence:CCGGGAGATCCCTAATCATCAAATTCTCGAGAATTTGATGATTAGGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3902s21c1
Sequence:GTACCGGAGACATCTTCCAAGCATATAACTCGAGTTATATGCTTGGAAGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3029s21c1
Sequence:CCGGTGACATCAGTGAGACCGATTTCTCGAGAAATCGGTCTCACTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003246.2-3226s21c1
Sequence:CCGGCCGAAAGGGACGATGACTATGCTCGAGCATAGTCATCGTCCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003246.2-3171s21c1
Sequence:CCGGGTAGGTTATGATGAGTTTAATCTCGAGATTAAACTCATCATAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.2-3638s1c1
Sequence:CCGGCTCTCAAGAAATGGTGTTCTTCTCGAGAAGAACACCATTTCTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.2-3005s1c1
Sequence:CCGGCGATGACATCTGTCCTGAGAACTCGAGTTCTCAGGACAGATGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039693    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003246.2-5343s1c1
Sequence:CCGGATCATCTGGTATACCATTGCCCTCGAGGGCAATGGTATACCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-879s1c1
Sequence:CCGGTAACTACATTGGCCACAAGACCTCGAGGTCTTGTGGCCAATGTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-2293s1c1
Sequence:CCGGGACTATGACAAGGATGGAATTCTCGAGAATTCCATCCTTGTCATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003246.x-1060s1c1
Sequence:CCGGCTATGCTATCACAACGGAGTTCTCGAGAACTCCGTTGTGATAGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-3593s1c1
Sequence:CCGGCTGACCTGAAATACGAATGTACTCGAGTACATTCGTATTTCAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003246.x-5343s1c1
Sequence:CCGGTATCATCTGGTATACCATTGCCTCGAGGCAATGGTATACCAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003246.x-3231s1c1
Sequence:CCGGAAGCAAGTCACCCAGTCCTACTCGAGTAGGACTGGGTGACTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks