EMAIL THIS PAGE TO A FRIEND

THBS2

thrombospondin 2

Synonyms: TSP2
UniProtKB ID: P35442, A6H8N1, A7E232, Q5RI52
Gene ID:
Human(7058) Summary: The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
Mouse(21826) thrombospondin 2
Rat(292406) thrombospondin 2
chicken(414837) thrombospondin 2
Horse(100050044) thrombospondin 2
domestic cat(101100567) thrombospondin 2
dog(484087) thrombospondin 2
naked mole-rat(101696497) thrombospondin 2
cow(338092) thrombospondin 2
sheep(101116840) thrombospondin 2
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003247 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003247 Rosetta Predictions human pricing
XM_001055515 Rosetta Predictions rat pricing
XM_214778 Rosetta Predictions rat pricing
NM_011581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029170 predicted 3274
2 SASI_Hs01_00029171 predicted 3654
3 SASI_Hs01_00029172 predicted 3314
4 SASI_Hs01_00029173 predicted 1129
5 SASI_Hs01_00029175 predicted 3179
6 SASI_Hs01_00029168 predicted 1334
7 SASI_Hs01_00029169 predicted 3753
8 SASI_Hs01_00029174 predicted 3709
9 SASI_Hs01_00029176 predicted 3747
10 SASI_Hs01_00029177 predicted 3334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279821 predicted 2010
2 SASI_Rn02_00279822 predicted 3573
3 SASI_Rn02_00279823 predicted 710
4 SASI_Rn02_00279824 predicted 1570
5 SASI_Rn02_00279825 predicted 1513
6 SASI_Rn02_00279826 predicted 2841
7 SASI_Rn02_00279827 predicted 3630
8 SASI_Rn02_00279828 predicted 1210
9 SASI_Rn02_00279829 predicted 1584
10 SASI_Rn02_00279830 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375585 predicted 2224
2 SASI_Rn02_00375586 predicted 3780
3 SASI_Rn02_00375587 predicted 920
4 SASI_Rn02_00375588 predicted 1785
5 SASI_Rn02_00375589 predicted 1720
6 SASI_Rn02_00375590 predicted 3044
7 SASI_Rn02_00375591 predicted 3847
8 SASI_Rn02_00375592 predicted 1423
9 SASI_Rn02_00375593 predicted 1797
10 SASI_Rn02_00375594 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026807 predicted 749
2 SASI_Mm01_00026808 predicted 2210
3 SASI_Mm01_00026809 predicted 2506
4 SASI_Mm01_00026810 predicted 1560
5 SASI_Mm01_00026811 predicted 2832
6 SASI_Mm01_00026812 predicted 1498
7 SASI_Mm01_00026813 predicted 3550
8 SASI_Mm01_00026814 predicted 1034
9 SASI_Mm01_00026815 predicted 2165
10 SASI_Mm01_00026816 predicted 1867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003247
THBS2 MISSION shRNA Bacterial Glycerol Stock
thrombospondin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-1178s1c1
Sequence:CCGGCCCTCCTAAGACAAGGAACATCTCGAGATGTTCCTTGTCTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-2670s1c1
Sequence:CCGGGTCTTCAATGAACGAGACAATCTCGAGATTGTCTCGTTCATTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-1137s1c1
Sequence:CCGGGTGTCGAATGATAACCAGTTTCTCGAGAAACTGGTTATCATTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-2606s1c1
Sequence:CCGGCCAGATCGACACAGACAACAACTCGAGTTGTTGTCTGTGTCGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-3743s1c1
Sequence:CCGGCAAGTACGAATGCAGAGATATCTCGAGATATCTCTGCATTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003247.2-3278s21c1
Sequence:CCGGCAGTGGCACATTCTACGTAAACTCGAGTTTACGTAGAATGTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003247.2-3928s21c1
Sequence:CCGCGTGCCTTCAGAGGATAAATATCTCGAGATATTTATCCTCTGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003247.2-1264s21c1
Sequence:CCGGCCACGTGTACCTGCAAGAAATCTCGAGATTTCTTGCAGGTACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003247.2-3986s21c1
Sequence:CCGGGAAACCAGTTTGGTGATATATCTCGAGATATATCACCAAACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003247
THBS2 MISSION shRNA shRNA Plasmid DNA
thrombospondin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-1178s1c1
Sequence:CCGGCCCTCCTAAGACAAGGAACATCTCGAGATGTTCCTTGTCTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-2670s1c1
Sequence:CCGGGTCTTCAATGAACGAGACAATCTCGAGATTGTCTCGTTCATTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-1137s1c1
Sequence:CCGGGTGTCGAATGATAACCAGTTTCTCGAGAAACTGGTTATCATTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-2606s1c1
Sequence:CCGGCCAGATCGACACAGACAACAACTCGAGTTGTTGTCTGTGTCGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-3743s1c1
Sequence:CCGGCAAGTACGAATGCAGAGATATCTCGAGATATCTCTGCATTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003247.2-3278s21c1
Sequence:CCGGCAGTGGCACATTCTACGTAAACTCGAGTTTACGTAGAATGTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003247.2-3928s21c1
Sequence:CCGCGTGCCTTCAGAGGATAAATATCTCGAGATATTTATCCTCTGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003247.2-1264s21c1
Sequence:CCGGCCACGTGTACCTGCAAGAAATCTCGAGATTTCTTGCAGGTACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003247.2-3986s21c1
Sequence:CCGGGAAACCAGTTTGGTGATATATCTCGAGATATATCACCAAACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003247
THBS2 MISSION shRNA Lentiviral Transduction Particles
thrombospondin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-1178s1c1
Sequence:CCGGCCCTCCTAAGACAAGGAACATCTCGAGATGTTCCTTGTCTTAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-2670s1c1
Sequence:CCGGGTCTTCAATGAACGAGACAATCTCGAGATTGTCTCGTTCATTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-1137s1c1
Sequence:CCGGGTGTCGAATGATAACCAGTTTCTCGAGAAACTGGTTATCATTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-2606s1c1
Sequence:CCGGCCAGATCGACACAGACAACAACTCGAGTTGTTGTCTGTGTCGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003247.2-3743s1c1
Sequence:CCGGCAAGTACGAATGCAGAGATATCTCGAGATATCTCTGCATTCGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003247.2-3278s21c1
Sequence:CCGGCAGTGGCACATTCTACGTAAACTCGAGTTTACGTAGAATGTGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003247.2-3928s21c1
Sequence:CCGCGTGCCTTCAGAGGATAAATATCTCGAGATATTTATCCTCTGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003247.2-1264s21c1
Sequence:CCGGCCACGTGTACCTGCAAGAAATCTCGAGATTTCTTGCAGGTACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003247.2-3986s21c1
Sequence:CCGGGAAACCAGTTTGGTGATATATCTCGAGATATATCACCAAACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011581
VALIDATED
THBS2 MISSION shRNA Bacterial Glycerol Stock
thrombospondin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011581.1-1861s1c1
Sequence:CCGGGCCCTATTGATGGGTGCTTATCTCGAGATAAGCACCCATCAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-3213s1c1
Sequence:CCGGGCTGTAGGTTTCGACGAGTTTCTCGAGAAACTCGTCGAAACCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-750s1c1
Sequence:CCGGCCATTCTATGAGCAGCTAGAACTCGAGTTCTAGCTGCTCATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-278s1c1
Sequence:CCGGCCACGTCAAGGACACTTCATTCTCGAGAATGAAGTGTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011581.1-2834s1c1
Sequence:CCGGCCAAGACAACTGCCCATACATCTCGAGATGTATGGGCAGTTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011581.3-4353s21c1
Sequence:CCGGGATTCGTGCTGTTCTATAATGCTCGAGCATTATAGAACAGCACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-3385s21c1
Sequence:CCGGGCTGTAGGTTTCGACGAGTTTCTCGAGAAACTCGTCGAAACCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-922s21c1
Sequence:CCGGCCATTCTATGAGCAGCTAGAACTCGAGTTCTAGCTGCTCATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-450s21c1
Sequence:CCGGCCACGTCAAGGACACTTCATTCTCGAGAATGAAGTGTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011581
VALIDATED
THBS2 MISSION shRNA shRNA Plasmid DNA
thrombospondin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011581.1-1861s1c1
Sequence:CCGGGCCCTATTGATGGGTGCTTATCTCGAGATAAGCACCCATCAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-3213s1c1
Sequence:CCGGGCTGTAGGTTTCGACGAGTTTCTCGAGAAACTCGTCGAAACCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-750s1c1
Sequence:CCGGCCATTCTATGAGCAGCTAGAACTCGAGTTCTAGCTGCTCATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-278s1c1
Sequence:CCGGCCACGTCAAGGACACTTCATTCTCGAGAATGAAGTGTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011581.1-2834s1c1
Sequence:CCGGCCAAGACAACTGCCCATACATCTCGAGATGTATGGGCAGTTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011581.3-4353s21c1
Sequence:CCGGGATTCGTGCTGTTCTATAATGCTCGAGCATTATAGAACAGCACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-3385s21c1
Sequence:CCGGGCTGTAGGTTTCGACGAGTTTCTCGAGAAACTCGTCGAAACCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-922s21c1
Sequence:CCGGCCATTCTATGAGCAGCTAGAACTCGAGTTCTAGCTGCTCATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-450s21c1
Sequence:CCGGCCACGTCAAGGACACTTCATTCTCGAGAATGAAGTGTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011581
VALIDATED
THBS2 MISSION shRNA Lentiviral Transduction Particles
thrombospondin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011581.1-1861s1c1
Sequence:CCGGGCCCTATTGATGGGTGCTTATCTCGAGATAAGCACCCATCAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-3213s1c1
Sequence:CCGGGCTGTAGGTTTCGACGAGTTTCTCGAGAAACTCGTCGAAACCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-750s1c1
Sequence:CCGGCCATTCTATGAGCAGCTAGAACTCGAGTTCTAGCTGCTCATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011581.1-278s1c1
Sequence:CCGGCCACGTCAAGGACACTTCATTCTCGAGAATGAAGTGTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011581.1-2834s1c1
Sequence:CCGGCCAAGACAACTGCCCATACATCTCGAGATGTATGGGCAGTTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011581.3-4353s21c1
Sequence:CCGGGATTCGTGCTGTTCTATAATGCTCGAGCATTATAGAACAGCACGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-3385s21c1
Sequence:CCGGGCTGTAGGTTTCGACGAGTTTCTCGAGAAACTCGTCGAAACCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-922s21c1
Sequence:CCGGCCATTCTATGAGCAGCTAGAACTCGAGTTCTAGCTGCTCATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011581.3-450s21c1
Sequence:CCGGCCACGTCAAGGACACTTCATTCTCGAGAATGAAGTGTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks