EMAIL THIS PAGE TO A FRIEND

THBS3

thrombospondin 3

Synonyms: TSP3
UniProtKB ID: P49746, B1AVR8, B4DQ20, Q8WV34
Gene ID:
Human(7059) Summary: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. [provided by RefSeq, Nov 2011]
Mouse(21827) thrombospondin 3
chicken(374130) thrombospondin 3
dog(610359) thrombospondin 3
Horse(100063449) thrombospondin 3
domestic cat(101093580) thrombospondin 3
cow(504323) thrombospondin 3
sheep(101116784) thrombospondin 3
naked mole-rat(101704466) thrombospondin 3
Domestic Rabbit(100343910) thrombospondin 3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007112 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007112 Rosetta Predictions human pricing
NM_013691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342969 predicted 276
2 SASI_Hs02_00342970 predicted 2396
3 SASI_Hs02_00342971 predicted 2398
4 SASI_Hs01_00210645 predicted 2372
5 SASI_Hs01_00210646 predicted 965
6 SASI_Hs01_00210648 predicted 777
7 SASI_Hs01_00210649 predicted 2246
8 SASI_Hs01_00210652 predicted 1820
9 SASI_Hs02_00342972 predicted 282
10 SASI_Hs02_00342973 predicted 2640
11 SASI_Hs01_00210643 predicted 1611
12 SASI_Hs01_00210644 predicted 2908
13 SASI_Hs01_00210647 predicted 2849
14 SASI_Hs01_00210650 predicted 527
15 SASI_Hs01_00210651 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144184 predicted 576
2 SASI_Mm01_00144185 predicted 2786
3 SASI_Mm01_00144186 predicted 1181
4 SASI_Mm01_00144187 predicted 1984
5 SASI_Mm01_00144188 predicted 2290
6 SASI_Mm01_00144189 predicted 2865
7 SASI_Mm01_00144190 predicted 199
8 SASI_Mm01_00144191 predicted 2630
9 SASI_Mm01_00144192 predicted 2188
10 SASI_Mm01_00144193 predicted 1840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013691
THBS3 MISSION shRNA Bacterial Glycerol Stock
thrombospondin 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000065428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-2350s1c1
Sequence:CCGGGCCTTTAATGGCGTGGACTTTCTCGAGAAAGTCCACGCCATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-1329s1c1
Sequence:CCGGCCACTGTCTCTTTGAACGCAACTCGAGTTGCGTTCAAAGAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-167s1c1
Sequence:CCGGCAGAGAAGATTCGGACAGCTTCTCGAGAAGCTGTCCGAATCTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-1188s1c1
Sequence:CCGGCCCAAATTCCATCTGCACCAACTCGAGTTGGTGCAGATGGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013691
THBS3 MISSION shRNA shRNA Plasmid DNA
thrombospondin 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000065428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-2350s1c1
Sequence:CCGGGCCTTTAATGGCGTGGACTTTCTCGAGAAAGTCCACGCCATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-1329s1c1
Sequence:CCGGCCACTGTCTCTTTGAACGCAACTCGAGTTGCGTTCAAAGAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-167s1c1
Sequence:CCGGCAGAGAAGATTCGGACAGCTTCTCGAGAAGCTGTCCGAATCTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-1188s1c1
Sequence:CCGGCCCAAATTCCATCTGCACCAACTCGAGTTGGTGCAGATGGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013691
THBS3 MISSION shRNA Lentiviral Transduction Particles
thrombospondin 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000065428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-2350s1c1
Sequence:CCGGGCCTTTAATGGCGTGGACTTTCTCGAGAAAGTCCACGCCATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-1329s1c1
Sequence:CCGGCCACTGTCTCTTTGAACGCAACTCGAGTTGCGTTCAAAGAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-167s1c1
Sequence:CCGGCAGAGAAGATTCGGACAGCTTCTCGAGAAGCTGTCCGAATCTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013691.1-1188s1c1
Sequence:CCGGCCCAAATTCCATCTGCACCAACTCGAGTTGGTGCAGATGGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007112
VALIDATED
THBS3 MISSION shRNA Bacterial Glycerol Stock
thrombospondin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-2906s1c1
Sequence:CCGGCCAGATTCAGAATTCAGAATTCTCGAGAATTCTGAATTCTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-2076s1c1
Sequence:CCGGCCCAATCAGAAGGACTCAGATCTCGAGATCTGAGTCCTTCTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-1431s1c1
Sequence:CCGGCCCTGCATGGACAACAACAAACTCGAGTTTGTTGTTGTCCATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007112.3-1825s1c1
Sequence:CCGGGCCCTGAAATGAGCAATCCTACTCGAGTAGGATTGCTCATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-794s1c1
Sequence:CCGGCCTGATCCGAAACACCATTATCTCGAGATAATGGTGTTTCGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007112
VALIDATED
THBS3 MISSION shRNA shRNA Plasmid DNA
thrombospondin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-2906s1c1
Sequence:CCGGCCAGATTCAGAATTCAGAATTCTCGAGAATTCTGAATTCTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-2076s1c1
Sequence:CCGGCCCAATCAGAAGGACTCAGATCTCGAGATCTGAGTCCTTCTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-1431s1c1
Sequence:CCGGCCCTGCATGGACAACAACAAACTCGAGTTTGTTGTTGTCCATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007112.3-1825s1c1
Sequence:CCGGGCCCTGAAATGAGCAATCCTACTCGAGTAGGATTGCTCATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-794s1c1
Sequence:CCGGCCTGATCCGAAACACCATTATCTCGAGATAATGGTGTTTCGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007112
VALIDATED
THBS3 MISSION shRNA Lentiviral Transduction Particles
thrombospondin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-2906s1c1
Sequence:CCGGCCAGATTCAGAATTCAGAATTCTCGAGAATTCTGAATTCTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-2076s1c1
Sequence:CCGGCCCAATCAGAAGGACTCAGATCTCGAGATCTGAGTCCTTCTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-1431s1c1
Sequence:CCGGCCCTGCATGGACAACAACAAACTCGAGTTTGTTGTTGTCCATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007112.3-1825s1c1
Sequence:CCGGGCCCTGAAATGAGCAATCCTACTCGAGTAGGATTGCTCATTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007112.3-794s1c1
Sequence:CCGGCCTGATCCGAAACACCATTATCTCGAGATAATGGTGTTTCGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks