EMAIL THIS PAGE TO A FRIEND

THBS4

thrombospondin 4

Synonyms: TSP4
UniProtKB ID: P35443, B2R909, Q86TG2
Gene ID:
Human(7060) Summary: The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. Studies of the rat counterpart suggest that this protein may be involved in local signaling in the developing and adult nervous system. [provided by RefSeq, Jul 2008]
Mouse(21828) thrombospondin 4
Rat(29220) thrombospondin 4
chicken(396306) thrombospondin 4
domestic cat(101087199) thrombospondin 4
dog(488930) thrombospondin 4
naked mole-rat(101726773) thrombospondin 4
cow(541281) thrombospondin 4
sheep(101115211) thrombospondin 4
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1176 Human TSP-4 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003248 Rosetta Predictions human pricing
XM_001066338 Rosetta Predictions rat pricing
XM_342172 Rosetta Predictions rat pricing
NM_011582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023062 predicted 2607
2 SASI_Hs01_00023063 predicted 2586
3 SASI_Hs01_00023064 predicted 2769
4 SASI_Hs01_00023065 predicted 1902
5 SASI_Hs01_00023066 predicted 1701
6 SASI_Hs02_00335287 predicted 534
7 SASI_Hs01_00023067 predicted 553
8 SASI_Hs01_00023069 predicted 1866
9 SASI_Hs01_00023070 predicted 505
10 SASI_Hs02_00335288 predicted 2701
11 SASI_Hs01_00023061 predicted 1622
12 SASI_Hs01_00023068 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317095 predicted 1471
2 SASI_Rn02_00317096 predicted 1184
3 SASI_Rn02_00317097 predicted 1725
4 SASI_Rn02_00317098 predicted 2346
5 SASI_Rn02_00317099 predicted 1063
6 SASI_Rn02_00317100 predicted 1410
7 SASI_Rn02_00317101 predicted 2346
8 SASI_Rn02_00317102 predicted 2379
9 SASI_Rn02_00317103 predicted 2116
10 SASI_Rn02_00317104 predicted 2517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393863 predicted 1850
2 SASI_Rn02_00393864 predicted 1567
3 SASI_Rn02_00393865 predicted 2111
4 SASI_Rn02_00393866 predicted 2721
5 SASI_Rn02_00393867 predicted 1435
6 SASI_Rn02_00393868 predicted 1780
7 SASI_Rn02_00393869 predicted 2724
8 SASI_Rn02_00393870 predicted 2755
9 SASI_Rn02_00393871 predicted 2501
10 SASI_Rn02_00393872 predicted 2902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104003 predicted 340
2 SASI_Mm01_00104004 predicted 1680
3 SASI_Mm01_00104005 predicted 2362
4 SASI_Mm01_00104006 predicted 1128
5 SASI_Mm01_00104007 predicted 2542
6 SASI_Mm02_00320974 predicted 2452
7 SASI_Mm01_00104008 predicted 593
8 SASI_Mm01_00104009 predicted 2762
9 SASI_Mm01_00104010 predicted 759
10 SASI_Mm01_00104012 predicted 2854
11 SASI_Mm01_00104011 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003248
THBS4 MISSION shRNA Bacterial Glycerol Stock
thrombospondin 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-485s1c1
Sequence:CCGGCCTGAATGATCTCTATGTGATCTCGAGATCACATAGAGATCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-1504s1c1
Sequence:CCGGGCGTTAATACTTTGGGATCTTCTCGAGAAGATCCCAAAGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-992s1c1
Sequence:CCGGCTTGGGTCAAATGACACAATTCTCGAGAATTGTGTCATTTGACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-2016s1c1
Sequence:CCGGGCCTGTGATGATGACATGGATCTCGAGATCCATGTCATCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-3156s1c1
Sequence:CCGGCCTGAGGACTTCCAAGAGTTTCTCGAGAAACTCTTGGAAGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-1911s21c1
Sequence:CCGGGACCAAAGGAACAGCGATAAACTCGAGTTTATCGCTGTTCCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-590s21c1
Sequence:CCGGTACTGTGATGGGACGCTTAAACTCGAGTTTAAGCGTCCCATCACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-3188s21c1
Sequence:CCGGTTTCGACCGCTTCGATAATTACTCGAGTAATTATCGAAGCGGTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003248
THBS4 MISSION shRNA shRNA Plasmid DNA
thrombospondin 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-485s1c1
Sequence:CCGGCCTGAATGATCTCTATGTGATCTCGAGATCACATAGAGATCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-1504s1c1
Sequence:CCGGGCGTTAATACTTTGGGATCTTCTCGAGAAGATCCCAAAGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-992s1c1
Sequence:CCGGCTTGGGTCAAATGACACAATTCTCGAGAATTGTGTCATTTGACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-2016s1c1
Sequence:CCGGGCCTGTGATGATGACATGGATCTCGAGATCCATGTCATCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-3156s1c1
Sequence:CCGGCCTGAGGACTTCCAAGAGTTTCTCGAGAAACTCTTGGAAGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-1911s21c1
Sequence:CCGGGACCAAAGGAACAGCGATAAACTCGAGTTTATCGCTGTTCCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-590s21c1
Sequence:CCGGTACTGTGATGGGACGCTTAAACTCGAGTTTAAGCGTCCCATCACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-3188s21c1
Sequence:CCGGTTTCGACCGCTTCGATAATTACTCGAGTAATTATCGAAGCGGTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003248
THBS4 MISSION shRNA Lentiviral Transduction Particles
thrombospondin 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-485s1c1
Sequence:CCGGCCTGAATGATCTCTATGTGATCTCGAGATCACATAGAGATCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-1504s1c1
Sequence:CCGGGCGTTAATACTTTGGGATCTTCTCGAGAAGATCCCAAAGTATTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-992s1c1
Sequence:CCGGCTTGGGTCAAATGACACAATTCTCGAGAATTGTGTCATTTGACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-2016s1c1
Sequence:CCGGGCCTGTGATGATGACATGGATCTCGAGATCCATGTCATCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003248.3-3156s1c1
Sequence:CCGGCCTGAGGACTTCCAAGAGTTTCTCGAGAAACTCTTGGAAGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-1911s21c1
Sequence:CCGGGACCAAAGGAACAGCGATAAACTCGAGTTTATCGCTGTTCCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-590s21c1
Sequence:CCGGTACTGTGATGGGACGCTTAAACTCGAGTTTAAGCGTCCCATCACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003248.3-3188s21c1
Sequence:CCGGTTTCGACCGCTTCGATAATTACTCGAGTAATTATCGAAGCGGTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011582
THBS4 MISSION shRNA Bacterial Glycerol Stock
thrombospondin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-397s1c1
Sequence:CCGGCCTGAAGAATGATGGAAAGATCTCGAGATCTTTCCATCATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-2573s1c1
Sequence:CCGGGCAGTAGCAGAACCTGGTATTCTCGAGAATACCAGGTTCTGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-595s1c1
Sequence:CCGGGTCCATTGAATTGCGGACATTCTCGAGAATGTCCGCAATTCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-1537s1c1
Sequence:CCGGCAAGAAGGATAACTGCAAGTACTCGAGTACTTGCAGTTATCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-2086s1c1
Sequence:CCGGCGATGACGATAACGATGGCATCTCGAGATGCCATCGTTATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011582
THBS4 MISSION shRNA shRNA Plasmid DNA
thrombospondin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-397s1c1
Sequence:CCGGCCTGAAGAATGATGGAAAGATCTCGAGATCTTTCCATCATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-2573s1c1
Sequence:CCGGGCAGTAGCAGAACCTGGTATTCTCGAGAATACCAGGTTCTGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-595s1c1
Sequence:CCGGGTCCATTGAATTGCGGACATTCTCGAGAATGTCCGCAATTCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-1537s1c1
Sequence:CCGGCAAGAAGGATAACTGCAAGTACTCGAGTACTTGCAGTTATCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-2086s1c1
Sequence:CCGGCGATGACGATAACGATGGCATCTCGAGATGCCATCGTTATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011582
THBS4 MISSION shRNA Lentiviral Transduction Particles
thrombospondin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-397s1c1
Sequence:CCGGCCTGAAGAATGATGGAAAGATCTCGAGATCTTTCCATCATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-2573s1c1
Sequence:CCGGGCAGTAGCAGAACCTGGTATTCTCGAGAATACCAGGTTCTGCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-595s1c1
Sequence:CCGGGTCCATTGAATTGCGGACATTCTCGAGAATGTCCGCAATTCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-1537s1c1
Sequence:CCGGCAAGAAGGATAACTGCAAGTACTCGAGTACTTGCAGTTATCCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011582.1-2086s1c1
Sequence:CCGGCGATGACGATAACGATGGCATCTCGAGATGCCATCGTTATCGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks