EMAIL THIS PAGE TO A FRIEND

THEG

theg spermatid protein

Synonyms: CT56 THEG1
UniProtKB ID: Q9P2T0, A6NMJ8
Gene ID:
Human(51298) Summary: This gene is specifically expressed in the nucleus of haploid male germ cells. The orthologous gene in mice encodes a protein that may play a role in protein assembly through interactions with T-complex protein 1 subunit epsilon. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(21830) testicular haploid expressed gene
Rat(299599) testicular haploid expressed gene
dog(476760) theg spermatid protein
domestic cat(101089496) theg spermatid protein
cow(788788) theg spermatid protein
sheep(101113587) theg spermatid protein
naked mole-rat(101724875) theg spermatid protein
domestic guinea pig(100735139) theg spermatid protein
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016585 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091381 MISSION® esiRNA esiRNA human THEG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016585 Rosetta Predictions human pricing
NM_199202 Rosetta Predictions human pricing
NM_001013102 Rosetta Predictions rat pricing
NM_011583 Rosetta Predictions mouse pricing
NM_199226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105295 predicted 958
2 SASI_Hs01_00105296 predicted 904
3 SASI_Hs01_00105297 predicted 964
4 SASI_Hs01_00105298 predicted 1075
5 SASI_Hs01_00105299 predicted 1079
6 SASI_Hs01_00105301 predicted 842
7 SASI_Hs01_00105302 predicted 752
8 SASI_Hs01_00105303 predicted 954
9 SASI_Hs02_00349716 predicted 756
10 SASI_Hs01_00105304 predicted 776
11 SASI_Hs01_00105300 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051698 predicted 890
2 SASI_Hs01_00051699 predicted 836
3 SASI_Hs01_00051700 predicted 891
4 SASI_Hs01_00051701 predicted 1006
5 SASI_Hs01_00051702 predicted 1003
6 SASI_Hs01_00051704 predicted 763
7 SASI_Hs01_00051705 predicted 679
8 SASI_Hs01_00051706 predicted 879
9 SASI_Hs02_00372659 predicted 685
10 SASI_Hs01_00051707 predicted 704
11 SASI_Hs01_00051703 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066990 predicted 619
2 SASI_Rn01_00066991 predicted 194
3 SASI_Rn01_00066992 predicted 492
4 SASI_Rn01_00066993 predicted 510
5 SASI_Rn01_00066994 predicted 737
6 SASI_Rn01_00066995 predicted 272
7 SASI_Rn01_00066996 predicted 740
8 SASI_Rn01_00066998 predicted 482
9 SASI_Rn02_00200767 predicted 313
10 SASI_Rn02_00200768 predicted 397
11 SASI_Rn01_00066997 predicted 918
12 SASI_Rn01_00066999 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153568 predicted 782
2 SASI_Mm01_00153569 predicted 762
3 SASI_Mm01_00153570 predicted 757
4 SASI_Mm01_00153571 predicted 911
5 SASI_Mm01_00153572 predicted 782
6 SASI_Mm01_00153573 predicted 957
7 SASI_Mm01_00153574 predicted 219
8 SASI_Mm01_00153575 predicted 980
9 SASI_Mm01_00153576 predicted 767
10 SASI_Mm01_00153577 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028282 predicted 715
2 SASI_Mm01_00028283 predicted 691
3 SASI_Mm01_00028284 predicted 683
4 SASI_Mm01_00028285 predicted 845
5 SASI_Mm01_00028286 predicted 703
6 SASI_Mm01_00028287 predicted 886
7 SASI_Mm01_00028288 predicted 219
8 SASI_Mm01_00028289 predicted 908
9 SASI_Mm01_00028290 predicted 691
10 SASI_Mm01_00028291 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016585
THEG MISSION shRNA Bacterial Glycerol Stock
theg spermatid protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-315s1c1
Sequence:CCGGCAAGGACTTGGAAGAGGACATCTCGAGATGTCCTCTTCCAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-274s1c1
Sequence:CCGGGATCCCAAAGAGGCACTTTCTCTCGAGAGAAAGTGCCTCTTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-436s1c1
Sequence:CCGGGAGCCCAAGATAAACTGGCAACTCGAGTTGCCAGTTTATCTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-516s1c1
Sequence:CCGGGATGAGCTTGCACTTCTGTCTCTCGAGAGACAGAAGTGCAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-453s1c1
Sequence:CCGGGCAAGTCCTGAAAGACAGGAACTCGAGTTCCTGTCTTTCAGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-286s1c1
Sequence:CCGGGCACTTTCTGAGTTGGAGAGACTCGAGTCTCTCCAACTCAGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-383s1c1
Sequence:CCGGCCATGACCAAAGCAAGGAAGACTCGAGTCTTCCTTGCTTTGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-438s1c1
Sequence:CCGGGCCCAAGATAAACTGGCAAGTCTCGAGACTTGCCAGTTTATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-752s1c1
Sequence:CCGGCGAAGATTCGTGATAACTTCTCTCGAGAGAAGTTATCACGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016585
THEG MISSION shRNA shRNA Plasmid DNA
theg spermatid protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-315s1c1
Sequence:CCGGCAAGGACTTGGAAGAGGACATCTCGAGATGTCCTCTTCCAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-274s1c1
Sequence:CCGGGATCCCAAAGAGGCACTTTCTCTCGAGAGAAAGTGCCTCTTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-436s1c1
Sequence:CCGGGAGCCCAAGATAAACTGGCAACTCGAGTTGCCAGTTTATCTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-516s1c1
Sequence:CCGGGATGAGCTTGCACTTCTGTCTCTCGAGAGACAGAAGTGCAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-453s1c1
Sequence:CCGGGCAAGTCCTGAAAGACAGGAACTCGAGTTCCTGTCTTTCAGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-286s1c1
Sequence:CCGGGCACTTTCTGAGTTGGAGAGACTCGAGTCTCTCCAACTCAGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-383s1c1
Sequence:CCGGCCATGACCAAAGCAAGGAAGACTCGAGTCTTCCTTGCTTTGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-438s1c1
Sequence:CCGGGCCCAAGATAAACTGGCAAGTCTCGAGACTTGCCAGTTTATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-752s1c1
Sequence:CCGGCGAAGATTCGTGATAACTTCTCTCGAGAGAAGTTATCACGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016585
THEG MISSION shRNA Lentiviral Transduction Particles
theg spermatid protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-315s1c1
Sequence:CCGGCAAGGACTTGGAAGAGGACATCTCGAGATGTCCTCTTCCAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-274s1c1
Sequence:CCGGGATCCCAAAGAGGCACTTTCTCTCGAGAGAAAGTGCCTCTTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-436s1c1
Sequence:CCGGGAGCCCAAGATAAACTGGCAACTCGAGTTGCCAGTTTATCTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-516s1c1
Sequence:CCGGGATGAGCTTGCACTTCTGTCTCTCGAGAGACAGAAGTGCAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-453s1c1
Sequence:CCGGGCAAGTCCTGAAAGACAGGAACTCGAGTTCCTGTCTTTCAGGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-286s1c1
Sequence:CCGGGCACTTTCTGAGTTGGAGAGACTCGAGTCTCTCCAACTCAGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016585.3-383s1c1
Sequence:CCGGCCATGACCAAAGCAAGGAAGACTCGAGTCTTCCTTGCTTTGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-438s1c1
Sequence:CCGGGCCCAAGATAAACTGGCAAGTCTCGAGACTTGCCAGTTTATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016585.3-752s1c1
Sequence:CCGGCGAAGATTCGTGATAACTTCTCTCGAGAGAAGTTATCACGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011583
THEG MISSION shRNA Bacterial Glycerol Stock
theg spermatid protein
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000106270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-767s1c1
Sequence:CCGGCGCAATAACATCTGGAGCATTCTCGAGAATGCTCCAGATGTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-919s1c1
Sequence:CCGGGCCTTACGTGTCAGACTATAACTCGAGTTATAGTCTGACACGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-125s1c1
Sequence:CCGGGTCAAGACTTTGGGAGAGTTACTCGAGTAACTCTCCCAAAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011583
THEG MISSION shRNA shRNA Plasmid DNA
theg spermatid protein
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000106270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-767s1c1
Sequence:CCGGCGCAATAACATCTGGAGCATTCTCGAGAATGCTCCAGATGTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-919s1c1
Sequence:CCGGGCCTTACGTGTCAGACTATAACTCGAGTTATAGTCTGACACGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-125s1c1
Sequence:CCGGGTCAAGACTTTGGGAGAGTTACTCGAGTAACTCTCCCAAAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011583
THEG MISSION shRNA Lentiviral Transduction Particles
theg spermatid protein
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000106270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-767s1c1
Sequence:CCGGCGCAATAACATCTGGAGCATTCTCGAGAATGCTCCAGATGTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-919s1c1
Sequence:CCGGGCCTTACGTGTCAGACTATAACTCGAGTTATAGTCTGACACGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011583.2-125s1c1
Sequence:CCGGGTCAAGACTTTGGGAGAGTTACTCGAGTAACTCTCCCAAAGTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks