EMAIL THIS PAGE TO A FRIEND

THEM4

thioesterase superfamily member 4

Synonyms: CTMP
UniProtKB ID: Q5T1C6, B2RBX2, Q96KR2
Gene ID:
Human(117145) Summary: Protein kinase B (PKB) is a major downstream target of receptor tyrosine kinases that signal via phosphatidylinositol 3-kinase. Upon cell stimulation, PKB is translocated to the plasma membrane, where it is phosphorylated in the C-terminal regulatory domain. The protein encoded by this gene negatively regulates PKB activity by inhibiting phosphorylation. Transcription of this gene is commonly downregulated in glioblastomas. [provided by RefSeq, Jul 2008]
Mouse(75778) thioesterase superfamily member 4
Rat(361992) thioesterase superfamily member 4
cow(787270) thioesterase superfamily member 4
naked mole-rat(101703857) thioesterase superfamily member 4
domestic guinea pig(100721204) thioesterase superfamily member 4
chicken(100858223) thioesterase superfamily member 4
domestic cat(101084812) thioesterase superfamily member 4
dog(609163) thioesterase superfamily member 4
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053055 Rosetta Predictions human pricing
NM_176853 Rosetta Predictions human pricing
NM_001025017 Rosetta Predictions rat pricing
NM_029431 Rosetta Predictions mouse pricing
XM_001003887 Rosetta Predictions mouse pricing
XM_131022 Rosetta Predictions mouse pricing
XM_895350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156300 predicted 664
2 SASI_Hs02_00361898 predicted 395
3 SASI_Hs02_00361899 predicted 825
4 SASI_Hs01_00156302 predicted 768
5 SASI_Hs01_00156303 predicted 854
6 SASI_Hs01_00156305 predicted 706
7 SASI_Hs02_00361900 predicted 417
8 SASI_Hs01_00156308 predicted 806
9 SASI_Hs02_00361901 predicted 759
10 SASI_Hs02_00361902 predicted 688
11 SASI_Hs01_00156299 predicted 739
12 SASI_Hs01_00156301 predicted 714
13 SASI_Hs01_00156304 predicted 735
14 SASI_Hs01_00156306 predicted 697
15 SASI_Hs01_00156307 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109572 predicted 978
2 SASI_Hs01_00109573 predicted 906
3 SASI_Hs01_00109574 predicted 938
4 SASI_Hs01_00109575 predicted 1003
5 SASI_Hs01_00109576 predicted 975
6 SASI_Hs01_00109577 predicted 947
7 SASI_Hs01_00109578 predicted 938
8 SASI_Hs01_00109579 predicted 946
9 SASI_Hs01_00109580 predicted 997
10 SASI_Hs01_00109581 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041287 predicted 576
2 SASI_Rn01_00041288 predicted 404
3 SASI_Rn01_00041289 predicted 345
4 SASI_Rn01_00041290 predicted 321
5 SASI_Rn01_00041291 predicted 693
6 SASI_Rn01_00041292 predicted 821
7 SASI_Rn01_00041293 predicted 687
8 SASI_Rn02_00202929 predicted 632
9 SASI_Rn01_00041295 predicted 567
10 SASI_Rn02_00202930 predicted 253
11 SASI_Rn01_00041294 predicted 751
12 SASI_Rn01_00041296 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335346 predicted 357
2 SASI_Mm02_00335347 predicted 635
3 SASI_Mm02_00335348 predicted 637
4 SASI_Mm02_00335349 predicted 684
5 SASI_Mm02_00335350 predicted 759
6 SASI_Mm02_00335351 predicted 210
7 SASI_Mm02_00335352 predicted 313
8 SASI_Mm02_00335353 predicted 756
9 SASI_Mm02_00335354 predicted 410
10 SASI_Mm02_00335355 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275665 predicted 403
2 SASI_Mm01_00275666 predicted 683
3 SASI_Mm01_00275667 predicted 678
4 SASI_Mm01_00275668 predicted 729
5 SASI_Mm01_00275669 predicted 802
6 SASI_Mm01_00275670 predicted 260
7 SASI_Mm01_00275671 predicted 798
8 SASI_Mm01_00275672 predicted 465
9 SASI_Mm01_00275673 predicted 307
10 SASI_Mm01_00275674 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215473 predicted 399
2 SASI_Mm01_00215474 predicted 660
3 SASI_Mm01_00215475 predicted 704
4 SASI_Mm01_00215476 predicted 267
5 SASI_Mm01_00215477 predicted 723
6 SASI_Mm01_00215478 predicted 832
7 SASI_Mm01_00215479 predicted 731
8 SASI_Mm01_00215480 predicted 717
9 SASI_Mm01_00215481 predicted 456
10 SASI_Mm01_00215482 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250373 predicted 283
2 SASI_Mm01_00250374 predicted 199
3 SASI_Mm01_00250375 predicted 267
4 SASI_Mm01_00250376 predicted 258
5 SASI_Mm01_00250377 predicted 289
6 SASI_Mm01_00250378 predicted 260
7 SASI_Mm01_00250379 predicted 286
8 SASI_Mm01_00250380 predicted 245
9 SASI_Mm01_00250381 predicted 337
10 SASI_Mm01_00250382 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053055
THEM4 MISSION shRNA Bacterial Glycerol Stock
thioesterase superfamily member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-609s1c1
Sequence:CCGGCCCTCTTTGTTCTGTTGTTATCTCGAGATAACAACAGAACAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-155s1c1
Sequence:CCGGCTTCTGAGGAAGTCATTCTTACTCGAGTAAGAATGACTTCCTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-707s1c1
Sequence:CCGGCCCTATACTCAGAGGCGACAACTCGAGTTGTCGCCTCTGAGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-218s1c1
Sequence:CCGGGACTGCTCTTTGACCAGTTTACTCGAGTAAACTGGTCAAAGAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-766s21c1
Sequence:CCGGTAAATAGCCAACTTGATAAAGCTCGAGCTTTATCAAGTTGGCTATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-550s21c1
Sequence:CCGCTGATGTTCTACAATGACATTGCTCGAGCAATGTCATTGTAGAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-640s21c1
Sequence:CCGGGTGCCATTGCAACCATGATTGCTCGAGCAATCATGGTTGCAATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053055
THEM4 MISSION shRNA shRNA Plasmid DNA
thioesterase superfamily member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-609s1c1
Sequence:CCGGCCCTCTTTGTTCTGTTGTTATCTCGAGATAACAACAGAACAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-155s1c1
Sequence:CCGGCTTCTGAGGAAGTCATTCTTACTCGAGTAAGAATGACTTCCTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-707s1c1
Sequence:CCGGCCCTATACTCAGAGGCGACAACTCGAGTTGTCGCCTCTGAGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-218s1c1
Sequence:CCGGGACTGCTCTTTGACCAGTTTACTCGAGTAAACTGGTCAAAGAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-766s21c1
Sequence:CCGGTAAATAGCCAACTTGATAAAGCTCGAGCTTTATCAAGTTGGCTATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-550s21c1
Sequence:CCGCTGATGTTCTACAATGACATTGCTCGAGCAATGTCATTGTAGAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-640s21c1
Sequence:CCGGGTGCCATTGCAACCATGATTGCTCGAGCAATCATGGTTGCAATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053055
THEM4 MISSION shRNA Lentiviral Transduction Particles
thioesterase superfamily member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-609s1c1
Sequence:CCGGCCCTCTTTGTTCTGTTGTTATCTCGAGATAACAACAGAACAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-155s1c1
Sequence:CCGGCTTCTGAGGAAGTCATTCTTACTCGAGTAAGAATGACTTCCTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-707s1c1
Sequence:CCGGCCCTATACTCAGAGGCGACAACTCGAGTTGTCGCCTCTGAGTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053055.2-218s1c1
Sequence:CCGGGACTGCTCTTTGACCAGTTTACTCGAGTAAACTGGTCAAAGAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-766s21c1
Sequence:CCGGTAAATAGCCAACTTGATAAAGCTCGAGCTTTATCAAGTTGGCTATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-550s21c1
Sequence:CCGCTGATGTTCTACAATGACATTGCTCGAGCAATGTCATTGTAGAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053055.3-640s21c1
Sequence:CCGGGTGCCATTGCAACCATGATTGCTCGAGCAATCATGGTTGCAATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029431
VALIDATED
THEM4 MISSION shRNA Bacterial Glycerol Stock
thioesterase superfamily member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-146s21c1
Sequence:CCGGGGAGCAGCTAGGAGGTTATTTCTCGAGAAATAACCTCCTAGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-589s21c1
Sequence:CCGGCAACCTCAACATCACCTATAACTCGAGTTATAGGTGATGTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029431.1-725s21c1
Sequence:CCGGACAGAGGCAACGGCCTTATTTCTCGAGAAATAAGGCCGTTGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029431.1-1425s21c1
Sequence:CCGGTAATGAAGAACTACAAGTTAGCTCGAGCTAACTTGTAGTTCTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-423s21c1
Sequence:CCGGAGTATGCGATGTTCTATAATACTCGAGTATTATAGAACATCGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029431
VALIDATED
THEM4 MISSION shRNA shRNA Plasmid DNA
thioesterase superfamily member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-146s21c1
Sequence:CCGGGGAGCAGCTAGGAGGTTATTTCTCGAGAAATAACCTCCTAGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-589s21c1
Sequence:CCGGCAACCTCAACATCACCTATAACTCGAGTTATAGGTGATGTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029431.1-725s21c1
Sequence:CCGGACAGAGGCAACGGCCTTATTTCTCGAGAAATAAGGCCGTTGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029431.1-1425s21c1
Sequence:CCGGTAATGAAGAACTACAAGTTAGCTCGAGCTAACTTGTAGTTCTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-423s21c1
Sequence:CCGGAGTATGCGATGTTCTATAATACTCGAGTATTATAGAACATCGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029431
VALIDATED
THEM4 MISSION shRNA Lentiviral Transduction Particles
thioesterase superfamily member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-146s21c1
Sequence:CCGGGGAGCAGCTAGGAGGTTATTTCTCGAGAAATAACCTCCTAGCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-589s21c1
Sequence:CCGGCAACCTCAACATCACCTATAACTCGAGTTATAGGTGATGTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029431.1-725s21c1
Sequence:CCGGACAGAGGCAACGGCCTTATTTCTCGAGAAATAAGGCCGTTGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029431.1-1425s21c1
Sequence:CCGGTAATGAAGAACTACAAGTTAGCTCGAGCTAACTTGTAGTTCTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029431.1-423s21c1
Sequence:CCGGAGTATGCGATGTTCTATAATACTCGAGTATTATAGAACATCGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks