EMAIL THIS PAGE TO A FRIEND

THEM5

thioesterase superfamily member 5

UniProtKB ID: Q8N1Q8, Q5T1C3
Gene ID:
Mouse(66198) thioesterase superfamily member 5
Rat(361993) thioesterase superfamily member 5
domestic cat(101082506) thioesterase superfamily member 5
dog(608399) thioesterase superfamily member 5
domestic guinea pig(100720929) thioesterase superfamily member 5
naked mole-rat(101702565) thioesterase superfamily member 5
cow(525765) thioesterase superfamily member 5
sheep(101119950) thioesterase superfamily member 5
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138181 MISSION® esiRNA esiRNA human THEM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182578 Rosetta Predictions human pricing
NM_001108558 Rosetta Predictions rat pricing
NM_025416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370708 predicted 620
2 SASI_Hs01_00136098 predicted 503
3 SASI_Hs01_00136099 predicted 508
4 SASI_Hs02_00370709 predicted 483
5 SASI_Hs01_00136102 predicted 616
6 SASI_Hs02_00370710 predicted 480
7 SASI_Hs02_00370711 predicted 316
8 SASI_Hs02_00370712 predicted 325
9 SASI_Hs01_00136105 predicted 534
10 SASI_Hs02_00370713 predicted 330
11 SASI_Hs01_00136097 predicted 538
12 SASI_Hs01_00136100 predicted 679
13 SASI_Hs01_00136101 predicted 670
14 SASI_Hs01_00136103 predicted 504
15 SASI_Hs01_00136104 predicted 547
16 SASI_Hs01_00136106 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239819 predicted 681
2 SASI_Rn02_00239820 predicted 499
3 SASI_Rn02_00239821 predicted 517
4 SASI_Rn02_00239822 predicted 882
5 SASI_Rn02_00239823 predicted 518
6 SASI_Rn02_00239824 predicted 301
7 SASI_Rn02_00239825 predicted 333
8 SASI_Rn02_00239826 predicted 605
9 SASI_Rn02_00239827 predicted 808
10 SASI_Rn02_00239828 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079175 predicted 698
2 SASI_Mm01_00079176 predicted 432
3 SASI_Mm01_00079177 predicted 194
4 SASI_Mm01_00079178 predicted 529
5 SASI_Mm01_00079179 predicted 366
6 SASI_Mm01_00079180 predicted 507
7 SASI_Mm01_00079181 predicted 497
8 SASI_Mm01_00079182 predicted 383
9 SASI_Mm01_00079183 predicted 251
10 SASI_Mm01_00079184 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182578
THEM5 MISSION shRNA Bacterial Glycerol Stock
thioesterase superfamily member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182578.2-622s21c1
Sequence:CCGGGCCATGATGGACGAGACCTTTCTCGAGAAAGGTCTCGTCCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182578.2-799s21c1
Sequence:CCGGAGAGACCAGCAGACAGTTTATCTCGAGATAAACTGTCTGCTGGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-330s1c1
Sequence:CCGGGCTGAGCCTGTACCAAGAATTCTCGAGAATTCTTGGTACAGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-276s1c1
Sequence:CCGGGAAGACAGACTTGAAGGATTACTCGAGTAATCCTTCAAGTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-459s1c1
Sequence:CCGGCAAAGGTGACTGTCGCATCTTCTCGAGAAGATGCGACAGTCACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-675s1c1
Sequence:CCGGGTTCACACTAAGTCTCAACATCTCGAGATGTTGAGACTTAGTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-739s1c1
Sequence:CCGGGACGTAGAAGTGGACAAGATTCTCGAGAATCTTGTCCACTTCTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182578
THEM5 MISSION shRNA shRNA Plasmid DNA
thioesterase superfamily member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182578.2-622s21c1
Sequence:CCGGGCCATGATGGACGAGACCTTTCTCGAGAAAGGTCTCGTCCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182578.2-799s21c1
Sequence:CCGGAGAGACCAGCAGACAGTTTATCTCGAGATAAACTGTCTGCTGGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-330s1c1
Sequence:CCGGGCTGAGCCTGTACCAAGAATTCTCGAGAATTCTTGGTACAGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-276s1c1
Sequence:CCGGGAAGACAGACTTGAAGGATTACTCGAGTAATCCTTCAAGTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-459s1c1
Sequence:CCGGCAAAGGTGACTGTCGCATCTTCTCGAGAAGATGCGACAGTCACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-675s1c1
Sequence:CCGGGTTCACACTAAGTCTCAACATCTCGAGATGTTGAGACTTAGTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-739s1c1
Sequence:CCGGGACGTAGAAGTGGACAAGATTCTCGAGAATCTTGTCCACTTCTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182578
THEM5 MISSION shRNA Lentiviral Transduction Particles
thioesterase superfamily member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182578.2-622s21c1
Sequence:CCGGGCCATGATGGACGAGACCTTTCTCGAGAAAGGTCTCGTCCATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182578.2-799s21c1
Sequence:CCGGAGAGACCAGCAGACAGTTTATCTCGAGATAAACTGTCTGCTGGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-330s1c1
Sequence:CCGGGCTGAGCCTGTACCAAGAATTCTCGAGAATTCTTGGTACAGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-276s1c1
Sequence:CCGGGAAGACAGACTTGAAGGATTACTCGAGTAATCCTTCAAGTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-459s1c1
Sequence:CCGGCAAAGGTGACTGTCGCATCTTCTCGAGAAGATGCGACAGTCACCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-675s1c1
Sequence:CCGGGTTCACACTAAGTCTCAACATCTCGAGATGTTGAGACTTAGTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182578.1-739s1c1
Sequence:CCGGGACGTAGAAGTGGACAAGATTCTCGAGAATCTTGTCCACTTCTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025416
THEM5 MISSION shRNA Bacterial Glycerol Stock
thioesterase superfamily member 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-700s21c1
Sequence:CCGGACTATTCACACTAAGTCTAAACTCGAGTTTAGACTTAGTGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-652s21c1
Sequence:CCGGCTTGATGGATGAGACATATTCCTCGAGGAATATGTCTCATCCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.2-701s1c1
Sequence:CCGGCTATTCACACTAAGTCTAAACCTCGAGGTTTAGACTTAGTGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.2-652s1c1
Sequence:CCGGCTTGATGGATGAGACATATTCCTCGAGGAATATGTCTCATCCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-196s21c1
Sequence:CCGGTGTCCGCCACAAAGCTCTTTACTCGAGTAAAGAGCTTTGTGGCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-437s21c1
Sequence:CCGGGATCATATCCAGGGCCTTAAGCTCGAGCTTAAGGCCCTGGATATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025416.2-918s21c1
Sequence:CCGGGATGACTCAGTGGCCACATAACTCGAGTTATGTGGCCACTGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025416.1-1051s1c1
Sequence:CCGGCCACAGATAACTCAGCAGTTACTCGAGTAACTGCTGAGTTATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.1-404s1c1
Sequence:CCGGCTGGATTAAACTACCCTCCTTCTCGAGAAGGAGGGTAGTTTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.1-403s1c1
Sequence:CCGGGCTGGATTAAACTACCCTCCTCTCGAGAGGAGGGTAGTTTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025416
THEM5 MISSION shRNA shRNA Plasmid DNA
thioesterase superfamily member 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-700s21c1
Sequence:CCGGACTATTCACACTAAGTCTAAACTCGAGTTTAGACTTAGTGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-652s21c1
Sequence:CCGGCTTGATGGATGAGACATATTCCTCGAGGAATATGTCTCATCCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.2-701s1c1
Sequence:CCGGCTATTCACACTAAGTCTAAACCTCGAGGTTTAGACTTAGTGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.2-652s1c1
Sequence:CCGGCTTGATGGATGAGACATATTCCTCGAGGAATATGTCTCATCCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-196s21c1
Sequence:CCGGTGTCCGCCACAAAGCTCTTTACTCGAGTAAAGAGCTTTGTGGCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-437s21c1
Sequence:CCGGGATCATATCCAGGGCCTTAAGCTCGAGCTTAAGGCCCTGGATATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025416.2-918s21c1
Sequence:CCGGGATGACTCAGTGGCCACATAACTCGAGTTATGTGGCCACTGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025416.1-1051s1c1
Sequence:CCGGCCACAGATAACTCAGCAGTTACTCGAGTAACTGCTGAGTTATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.1-404s1c1
Sequence:CCGGCTGGATTAAACTACCCTCCTTCTCGAGAAGGAGGGTAGTTTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.1-403s1c1
Sequence:CCGGGCTGGATTAAACTACCCTCCTCTCGAGAGGAGGGTAGTTTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025416
THEM5 MISSION shRNA Lentiviral Transduction Particles
thioesterase superfamily member 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-700s21c1
Sequence:CCGGACTATTCACACTAAGTCTAAACTCGAGTTTAGACTTAGTGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-652s21c1
Sequence:CCGGCTTGATGGATGAGACATATTCCTCGAGGAATATGTCTCATCCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.2-701s1c1
Sequence:CCGGCTATTCACACTAAGTCTAAACCTCGAGGTTTAGACTTAGTGTGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.2-652s1c1
Sequence:CCGGCTTGATGGATGAGACATATTCCTCGAGGAATATGTCTCATCCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-196s21c1
Sequence:CCGGTGTCCGCCACAAAGCTCTTTACTCGAGTAAAGAGCTTTGTGGCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025416.2-437s21c1
Sequence:CCGGGATCATATCCAGGGCCTTAAGCTCGAGCTTAAGGCCCTGGATATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025416.2-918s21c1
Sequence:CCGGGATGACTCAGTGGCCACATAACTCGAGTTATGTGGCCACTGAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025416.1-1051s1c1
Sequence:CCGGCCACAGATAACTCAGCAGTTACTCGAGTAACTGCTGAGTTATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.1-404s1c1
Sequence:CCGGCTGGATTAAACTACCCTCCTTCTCGAGAAGGAGGGTAGTTTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025416.1-403s1c1
Sequence:CCGGGCTGGATTAAACTACCCTCCTCTCGAGAGGAGGGTAGTTTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks