EMAIL THIS PAGE TO A FRIEND

THEM6

thioesterase superfamily member 6

Synonyms: C8orf55 DSCD75
UniProtKB ID: Q8WUY1, B2RDN6, Q8NBN2, Q9NYI2
Gene ID:
Mouse(223626) thioesterase superfamily member 6
Rat(300015) thioesterase superfamily member 6
cow(516073) thioesterase superfamily member 6
sheep(101119647) thioesterase superfamily member 6
domestic guinea pig(100721260) thioesterase superfamily member 6
domestic cat(101086950) thioesterase superfamily member 6
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016647 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016647 Rosetta Predictions human pricing
NM_001007658 Rosetta Predictions rat pricing
NM_198607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165566 predicted 1000
2 SASI_Hs01_00165567 predicted 835
3 SASI_Hs01_00165568 predicted 1097
4 SASI_Hs01_00165569 predicted 1234
5 SASI_Hs01_00165570 predicted 828
6 SASI_Hs01_00165571 predicted 965
7 SASI_Hs01_00165573 predicted 1170
8 SASI_Hs01_00165575 predicted 1066
9 SASI_Hs02_00349817 predicted 1206
10 SASI_Hs01_00165572 predicted 341
11 SASI_Hs01_00165574 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061946 predicted 419
2 SASI_Rn02_00198782 predicted 1118
3 SASI_Rn01_00061948 predicted 214
4 SASI_Rn02_00198783 predicted 1120
5 SASI_Rn01_00061949 predicted 534
6 SASI_Rn01_00061950 predicted 1146
7 SASI_Rn01_00061951 predicted 296
8 SASI_Rn01_00061952 predicted 1079
9 SASI_Rn01_00061953 predicted 1074
10 SASI_Rn01_00061954 predicted 496
11 SASI_Rn01_00061947 predicted 422
12 SASI_Rn01_00061955 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178179 predicted 772
2 SASI_Mm01_00178180 predicted 1110
3 SASI_Mm01_00178181 predicted 260
4 SASI_Mm01_00178182 predicted 759
5 SASI_Mm01_00178183 predicted 1093
6 SASI_Mm01_00178184 predicted 1126
7 SASI_Mm01_00178185 predicted 406
8 SASI_Mm01_00178186 predicted 1114
9 SASI_Mm01_00178187 predicted 1035
10 SASI_Mm01_00178188 predicted 447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198607
THEM6 MISSION shRNA Bacterial Glycerol Stock
thioesterase superfamily member 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198607.1-548s1c1
Sequence:CCGGGTAGTACAGCACTTGTGCAAACTCGAGTTTGCACAAGTGCTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198607.1-608s1c1
Sequence:CCGGCATTGGATCTCCTACAATGAGCTCGAGCTCATTGTAGGAGATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198607.1-1158s21c1
Sequence:CCGGACCACTCTTAAGAGGATATACCTCGAGGTATATCCTCTTAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-549s21c1
Sequence:CCGGTAGTACAGCACTTGTGCAAACCTCGAGGTTTGCACAAGTGCTGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-472s21c1
Sequence:CCGGTGTCAGCCTTCGCGATGGTTTCTCGAGAAACCATCGCGAAGGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-191s21c1
Sequence:CCGGTTATTGGCGGAGCAGCGGTATCTCGAGATACCGCTGCTCCGCCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-400s21c1
Sequence:CCGGGTTTGAGCCGTTCGAGGTACACTCGAGTGTACCTCGAACGGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198607
THEM6 MISSION shRNA shRNA Plasmid DNA
thioesterase superfamily member 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198607.1-548s1c1
Sequence:CCGGGTAGTACAGCACTTGTGCAAACTCGAGTTTGCACAAGTGCTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198607.1-608s1c1
Sequence:CCGGCATTGGATCTCCTACAATGAGCTCGAGCTCATTGTAGGAGATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198607.1-1158s21c1
Sequence:CCGGACCACTCTTAAGAGGATATACCTCGAGGTATATCCTCTTAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-549s21c1
Sequence:CCGGTAGTACAGCACTTGTGCAAACCTCGAGGTTTGCACAAGTGCTGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-472s21c1
Sequence:CCGGTGTCAGCCTTCGCGATGGTTTCTCGAGAAACCATCGCGAAGGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-191s21c1
Sequence:CCGGTTATTGGCGGAGCAGCGGTATCTCGAGATACCGCTGCTCCGCCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-400s21c1
Sequence:CCGGGTTTGAGCCGTTCGAGGTACACTCGAGTGTACCTCGAACGGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198607
THEM6 MISSION shRNA Lentiviral Transduction Particles
thioesterase superfamily member 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198607.1-548s1c1
Sequence:CCGGGTAGTACAGCACTTGTGCAAACTCGAGTTTGCACAAGTGCTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198607.1-608s1c1
Sequence:CCGGCATTGGATCTCCTACAATGAGCTCGAGCTCATTGTAGGAGATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198607.1-1158s21c1
Sequence:CCGGACCACTCTTAAGAGGATATACCTCGAGGTATATCCTCTTAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-549s21c1
Sequence:CCGGTAGTACAGCACTTGTGCAAACCTCGAGGTTTGCACAAGTGCTGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-472s21c1
Sequence:CCGGTGTCAGCCTTCGCGATGGTTTCTCGAGAAACCATCGCGAAGGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-191s21c1
Sequence:CCGGTTATTGGCGGAGCAGCGGTATCTCGAGATACCGCTGCTCCGCCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198607.1-400s21c1
Sequence:CCGGGTTTGAGCCGTTCGAGGTACACTCGAGTGTACCTCGAACGGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016647
VALIDATED
THEM6 MISSION shRNA Bacterial Glycerol Stock
thioesterase superfamily member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-733s21c1
Sequence:CCGGATGGAGAGTGGGCTCAGTGATCTCGAGATCACTGAGCCCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-324s21c1
Sequence:CCGGCCTGCTGCTGCACATGAACAACTCGAGTTGTTCATGTGCAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-1714s21c1
Sequence:CCGGACTCCTCTGTCCTCTATATTCCTCGAGGAATATAGAGGACAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016647.2-689s21c1
Sequence:CCGGAGCACTGGATCTCCTACAACGCTCGAGCGTTGTAGGAGATCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-751s21c1
Sequence:CCGGGATGTCACCAAGGACCAGTGACTCGAGTCACTGGTCCTTGGTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016647
VALIDATED
THEM6 MISSION shRNA shRNA Plasmid DNA
thioesterase superfamily member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-733s21c1
Sequence:CCGGATGGAGAGTGGGCTCAGTGATCTCGAGATCACTGAGCCCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-324s21c1
Sequence:CCGGCCTGCTGCTGCACATGAACAACTCGAGTTGTTCATGTGCAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-1714s21c1
Sequence:CCGGACTCCTCTGTCCTCTATATTCCTCGAGGAATATAGAGGACAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016647.2-689s21c1
Sequence:CCGGAGCACTGGATCTCCTACAACGCTCGAGCGTTGTAGGAGATCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-751s21c1
Sequence:CCGGGATGTCACCAAGGACCAGTGACTCGAGTCACTGGTCCTTGGTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016647
VALIDATED
THEM6 MISSION shRNA Lentiviral Transduction Particles
thioesterase superfamily member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-733s21c1
Sequence:CCGGATGGAGAGTGGGCTCAGTGATCTCGAGATCACTGAGCCCACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-324s21c1
Sequence:CCGGCCTGCTGCTGCACATGAACAACTCGAGTTGTTCATGTGCAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-1714s21c1
Sequence:CCGGACTCCTCTGTCCTCTATATTCCTCGAGGAATATAGAGGACAGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016647.2-689s21c1
Sequence:CCGGAGCACTGGATCTCCTACAACGCTCGAGCGTTGTAGGAGATCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016647.2-751s21c1
Sequence:CCGGGATGTCACCAAGGACCAGTGACTCGAGTCACTGGTCCTTGGTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks