EMAIL THIS PAGE TO A FRIEND

THEMIS2

thymocyte selection associated family member 2

Synonyms: C1orf38 ICB-1
Gene ID:
Mouse(230787) thymocyte selection associated family member 2
Rat(500561) thymocyte selection associated family member 2
cow(507126) thymocyte selection associated family member 2
sheep(101111945) thymocyte selection associated family member 2
naked mole-rat(101708208) thymocyte selection associated family member 2
domestic guinea pig(100721529) thymocyte selection associated family member 2
domestic cat(101090631) thymocyte selection associated family member 2
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004848 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU171681 MISSION® esiRNA esiRNA targeting mouse BC013712 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039477 Rosetta Predictions human pricing
NM_001105556 Rosetta Predictions human pricing
NM_004848 Rosetta Predictions human pricing
XM_001064217 Rosetta Predictions rat pricing
XM_575925 Rosetta Predictions rat pricing
NM_001033308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227589 predicted 680
2 SASI_Hs01_00227590 predicted 842
3 SASI_Hs01_00227591 predicted 644
4 SASI_Hs01_00227592 predicted 803
5 SASI_Hs01_00227594 predicted 605
6 SASI_Hs02_00308522 predicted 503
7 SASI_Hs01_00227596 predicted 719
8 SASI_Hs01_00227597 predicted 592
9 SASI_Hs01_00227598 predicted 473
10 SASI_Hs02_00308523 predicted 305
11 SASI_Hs01_00227593 predicted 716
12 SASI_Hs01_00227595 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324401 predicted 2161
2 SASI_Hs02_00324402 predicted 2325
3 SASI_Hs02_00324403 predicted 2429
4 SASI_Hs02_00324404 predicted 2433
5 SASI_Hs02_00324405 predicted 2124
6 SASI_Hs02_00324406 predicted 2286
7 SASI_Hs02_00324407 predicted 2423
8 SASI_Hs02_00324408 predicted 2422
9 SASI_Hs02_00324409 predicted 2087
10 SASI_Hs02_00324410 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130861 predicted 1045
2 SASI_Hs01_00130862 predicted 1048
3 SASI_Hs02_00338434 predicted 886
4 SASI_Hs01_00130864 predicted 1004
5 SASI_Hs01_00130865 predicted 922
6 SASI_Hs01_00130866 predicted 1016
7 SASI_Hs01_00130867 predicted 876
8 SASI_Hs01_00130868 predicted 959
9 SASI_Hs01_00130869 predicted 915
10 SASI_Hs01_00130870 predicted 890
11 SASI_Hs01_00130863 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309697 predicted 1636
2 SASI_Rn02_00309698 predicted 781
3 SASI_Rn02_00309699 predicted 601
4 SASI_Rn02_00309700 predicted 576
5 SASI_Rn02_00309701 predicted 608
6 SASI_Rn02_00309702 predicted 652
7 SASI_Rn02_00309703 predicted 1649
8 SASI_Rn02_00309704 predicted 493
9 SASI_Rn02_00309705 predicted 1423
10 SASI_Rn02_00309706 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404533 predicted 686
2 SASI_Rn02_00404534 predicted 662
3 SASI_Rn02_00404535 predicted 690
4 SASI_Rn02_00404536 predicted 898
5 SASI_Rn02_00404537 predicted 337
6 SASI_Rn02_00404538 predicted 414
7 SASI_Rn02_00404539 predicted 734
8 SASI_Rn02_00404540 predicted 225
9 SASI_Rn02_00404541 predicted 576
10 SASI_Rn02_00404542 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123925 predicted 338
2 SASI_Mm01_00123926 predicted 1828
3 SASI_Mm01_00123927 predicted 1991
4 SASI_Mm01_00123928 predicted 1163
5 SASI_Mm01_00123929 predicted 1670
6 SASI_Mm01_00123930 predicted 876
7 SASI_Mm01_00123931 predicted 1155
8 SASI_Mm01_00123932 predicted 1963
9 SASI_Mm01_00123933 predicted 1326
10 SASI_Mm01_00123934 predicted 1716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004848
THEMIS2 MISSION shRNA Bacterial Glycerol Stock
thymocyte selection associated family member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004848.1-396s1c1
Sequence:CCGGCGGCACGTCCACTTTATCAAACTCGAGTTTGATAAAGTGGACGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-670s21c1
Sequence:CCGGGCACATCTTCTCAAGTCTTAGCTCGAGCTAAGACTTGAGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004848.2-1401s21c1
Sequence:CCGGATGTGGTTAACATGGATTAATCTCGAGATTAATCCATGTTAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-760s21c1
Sequence:CCGGCCAGTACGTACAGCAAGATTCCTCGAGGAATCTTGCTGTACGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-114s21c1
Sequence:CCGGACTTCGAGGGCTCCATCTATGCTCGAGCATAGATGGAGCCCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-573s21c1
Sequence:CCGGTACAGGATCCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGGATCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004848
THEMIS2 MISSION shRNA shRNA Plasmid DNA
thymocyte selection associated family member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004848.1-396s1c1
Sequence:CCGGCGGCACGTCCACTTTATCAAACTCGAGTTTGATAAAGTGGACGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-670s21c1
Sequence:CCGGGCACATCTTCTCAAGTCTTAGCTCGAGCTAAGACTTGAGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004848.2-1401s21c1
Sequence:CCGGATGTGGTTAACATGGATTAATCTCGAGATTAATCCATGTTAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-760s21c1
Sequence:CCGGCCAGTACGTACAGCAAGATTCCTCGAGGAATCTTGCTGTACGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-114s21c1
Sequence:CCGGACTTCGAGGGCTCCATCTATGCTCGAGCATAGATGGAGCCCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-573s21c1
Sequence:CCGGTACAGGATCCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGGATCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004848
THEMIS2 MISSION shRNA Lentiviral Transduction Particles
thymocyte selection associated family member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004848.1-396s1c1
Sequence:CCGGCGGCACGTCCACTTTATCAAACTCGAGTTTGATAAAGTGGACGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-670s21c1
Sequence:CCGGGCACATCTTCTCAAGTCTTAGCTCGAGCTAAGACTTGAGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004848.2-1401s21c1
Sequence:CCGGATGTGGTTAACATGGATTAATCTCGAGATTAATCCATGTTAACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-760s21c1
Sequence:CCGGCCAGTACGTACAGCAAGATTCCTCGAGGAATCTTGCTGTACGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-114s21c1
Sequence:CCGGACTTCGAGGGCTCCATCTATGCTCGAGCATAGATGGAGCCCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004848.2-573s21c1
Sequence:CCGGTACAGGATCCAGCCCTGAAAGCTCGAGCTTTCAGGGCTGGATCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033308
THEMIS2 MISSION shRNA Bacterial Glycerol Stock
thymocyte selection associated family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-602s21c1
Sequence:CCGGCTGGAACTCCGTGATCCTAAACTCGAGTTTAGGATCACGGAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-1678s21c1
Sequence:CCGGCAAAGAGCCAGGGTATCAATACTCGAGTATTGATACCCTGGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033308.2-2273s21c1
Sequence:CCGGAGGCACAGAGAAGGATCAAAGCTCGAGCTTTGATCCTTCTCTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-1316s21c1
Sequence:CCGGGAACGACAGCCGACGCTATAACTCGAGTTATAGCGTCGGCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-106s21c1
Sequence:CCGGGTTCCGTCTACGAGCTCTTTGCTCGAGCAAAGAGCTCGTAGACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033308
THEMIS2 MISSION shRNA shRNA Plasmid DNA
thymocyte selection associated family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-602s21c1
Sequence:CCGGCTGGAACTCCGTGATCCTAAACTCGAGTTTAGGATCACGGAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-1678s21c1
Sequence:CCGGCAAAGAGCCAGGGTATCAATACTCGAGTATTGATACCCTGGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033308.2-2273s21c1
Sequence:CCGGAGGCACAGAGAAGGATCAAAGCTCGAGCTTTGATCCTTCTCTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-1316s21c1
Sequence:CCGGGAACGACAGCCGACGCTATAACTCGAGTTATAGCGTCGGCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-106s21c1
Sequence:CCGGGTTCCGTCTACGAGCTCTTTGCTCGAGCAAAGAGCTCGTAGACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033308
THEMIS2 MISSION shRNA Lentiviral Transduction Particles
thymocyte selection associated family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-602s21c1
Sequence:CCGGCTGGAACTCCGTGATCCTAAACTCGAGTTTAGGATCACGGAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-1678s21c1
Sequence:CCGGCAAAGAGCCAGGGTATCAATACTCGAGTATTGATACCCTGGCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033308.2-2273s21c1
Sequence:CCGGAGGCACAGAGAAGGATCAAAGCTCGAGCTTTGATCCTTCTCTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-1316s21c1
Sequence:CCGGGAACGACAGCCGACGCTATAACTCGAGTTATAGCGTCGGCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033308.2-106s21c1
Sequence:CCGGGTTCCGTCTACGAGCTCTTTGCTCGAGCAAAGAGCTCGTAGACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks