EMAIL THIS PAGE TO A FRIEND

THEMIS

thymocyte selection associated

Synonyms: C6orf190 C6orf207 GASP SPOT TSEPA bA325O24.3 bA325O24.4
Gene ID:
Human(387357) Summary: This gene encodes a protein that plays a regulatory role in both positive and negative T-cell selection during late thymocyte development. The protein functions through T-cell antigen receptor signaling, and is necessary for proper lineage commitment and maturation of T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(210757) thymocyte selection associated
Zebrafish(555433) thymocyte selection associated
chicken(769224) thymocyte selection associated
Horse(100073059) thymocyte selection associated
domestic cat(101092116) thymocyte selection associated
dog(484120) thymocyte selection associated
domestic guinea pig(100731099) thymocyte selection associated
naked mole-rat(101722863) thymocyte selection associated
cow(540554) thymocyte selection associated
sheep(101118109) thymocyte selection associated
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376535 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010923 Rosetta Predictions human pricing
NM_178666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196150 predicted 2257
2 SASI_Hs01_00196151 predicted 509
3 SASI_Hs02_00305914 predicted 496
4 SASI_Hs01_00196152 predicted 529
5 SASI_Hs01_00196153 predicted 1253
6 SASI_Hs01_00196154 predicted 537
7 SASI_Hs02_00305915 predicted 1323
8 SASI_Hs01_00196156 predicted 1078
9 SASI_Hs01_00196157 predicted 2195
10 SASI_Hs01_00196158 predicted 944
11 SASI_Hs01_00196155 predicted 392
12 SASI_Hs01_00196159 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151450 predicted 457
2 SASI_Mm02_00349122 predicted 1430
3 SASI_Mm01_00151451 predicted 338
4 SASI_Mm01_00151452 predicted 708
5 SASI_Mm01_00151454 predicted 385
6 SASI_Mm01_00151455 predicted 1376
7 SASI_Mm02_00349123 predicted 1265
8 SASI_Mm01_00151456 predicted 2255
9 SASI_Mm01_00151457 predicted 543
10 SASI_Mm01_00151458 predicted 1703
11 SASI_Mm01_00151453 predicted 802
12 SASI_Mm01_00151459 predicted 1546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178666
THEMIS MISSION shRNA Bacterial Glycerol Stock
thymocyte selection associated
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000198175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178666.3-861s1c1
Sequence:CCGGCGGACAGTGAAACTTACAGATCTCGAGATCTGTAAGTTTCACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3772s1c1
Sequence:CCGGGCACAGTTGAATTTGGACTTTCTCGAGAAAGTCCAAATTCAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3672s1c1
Sequence:CCGGCCCAACCACATATCCTAAGAACTCGAGTTCTTAGGATATGTGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3673s1c1
Sequence:CCGGCCAACCACATATCCTAAGAAACTCGAGTTTCTTAGGATATGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178666
THEMIS MISSION shRNA shRNA Plasmid DNA
thymocyte selection associated
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000198175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178666.3-861s1c1
Sequence:CCGGCGGACAGTGAAACTTACAGATCTCGAGATCTGTAAGTTTCACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3772s1c1
Sequence:CCGGGCACAGTTGAATTTGGACTTTCTCGAGAAAGTCCAAATTCAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3672s1c1
Sequence:CCGGCCCAACCACATATCCTAAGAACTCGAGTTCTTAGGATATGTGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3673s1c1
Sequence:CCGGCCAACCACATATCCTAAGAAACTCGAGTTTCTTAGGATATGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178666
THEMIS MISSION shRNA Lentiviral Transduction Particles
thymocyte selection associated
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000198175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178666.3-861s1c1
Sequence:CCGGCGGACAGTGAAACTTACAGATCTCGAGATCTGTAAGTTTCACTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3772s1c1
Sequence:CCGGGCACAGTTGAATTTGGACTTTCTCGAGAAAGTCCAAATTCAACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3672s1c1
Sequence:CCGGCCCAACCACATATCCTAAGAACTCGAGTTCTTAGGATATGTGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178666.3-3673s1c1
Sequence:CCGGCCAACCACATATCCTAAGAAACTCGAGTTTCTTAGGATATGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376535
THEMIS MISSION shRNA Bacterial Glycerol Stock
thymocyte selection associated
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-970s1c1
Sequence:CCGGCCCATAGTGACTGAAGTCATACTCGAGTATGACTTCAGTCACTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-891s1c1
Sequence:CCGGCACTGATTCTTACGATGCTAACTCGAGTTAGCATCGTAAGAATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-537s1c1
Sequence:CCGGGCTCAACTCAGTTGAAGAGATCTCGAGATCTCTTCAACTGAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-1726s1c1
Sequence:CCGGGAGATCACTGAAGAGCAATATCTCGAGATATTGCTCTTCAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-648s1c1
Sequence:CCGGCGAGTGTGAAGATGAACGTATCTCGAGATACGTTCATCTTCACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376535
THEMIS MISSION shRNA shRNA Plasmid DNA
thymocyte selection associated
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-970s1c1
Sequence:CCGGCCCATAGTGACTGAAGTCATACTCGAGTATGACTTCAGTCACTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-891s1c1
Sequence:CCGGCACTGATTCTTACGATGCTAACTCGAGTTAGCATCGTAAGAATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-537s1c1
Sequence:CCGGGCTCAACTCAGTTGAAGAGATCTCGAGATCTCTTCAACTGAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-1726s1c1
Sequence:CCGGGAGATCACTGAAGAGCAATATCTCGAGATATTGCTCTTCAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-648s1c1
Sequence:CCGGCGAGTGTGAAGATGAACGTATCTCGAGATACGTTCATCTTCACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376535
THEMIS MISSION shRNA Lentiviral Transduction Particles
thymocyte selection associated
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-970s1c1
Sequence:CCGGCCCATAGTGACTGAAGTCATACTCGAGTATGACTTCAGTCACTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-891s1c1
Sequence:CCGGCACTGATTCTTACGATGCTAACTCGAGTTAGCATCGTAAGAATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-537s1c1
Sequence:CCGGGCTCAACTCAGTTGAAGAGATCTCGAGATCTCTTCAACTGAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-1726s1c1
Sequence:CCGGGAGATCACTGAAGAGCAATATCTCGAGATATTGCTCTTCAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376535.1-648s1c1
Sequence:CCGGCGAGTGTGAAGATGAACGTATCTCGAGATACGTTCATCTTCACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks