EMAIL THIS PAGE TO A FRIEND

THG1L

tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)

Synonyms: ICF45 IHG-1
UniProtKB ID: Q9NWX6, D3DQJ5, Q53G12, Q7L5R3, Q9H0S2
Gene ID:
Mouse(66628) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Rat(303067) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Zebrafish(492814) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
chicken(416242) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
domestic cat(101080614) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
dog(479315) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
cow(507084) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
sheep(101113674) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
domestic guinea pig(100731482) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
naked mole-rat(101705954) tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080969 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080969 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080969 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017872 Rosetta Predictions human pricing
NM_001013966 Rosetta Predictions rat pricing
NM_001080969 Rosetta Predictions mouse pricing
XM_126359 Rosetta Predictions mouse pricing
XM_896348 Rosetta Predictions mouse pricing
XM_896362 Rosetta Predictions mouse pricing
XM_896377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087180 predicted 829
2 SASI_Hs01_00087182 predicted 425
3 SASI_Hs01_00087183 predicted 234
4 SASI_Hs01_00087184 predicted 619
5 SASI_Hs01_00087185 predicted 293
6 SASI_Hs01_00087186 predicted 815
7 SASI_Hs01_00087187 predicted 434
8 SASI_Hs01_00087188 predicted 724
9 SASI_Hs02_00350812 predicted 390
10 SASI_Hs01_00087189 predicted 984
11 SASI_Hs01_00087181 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036030 predicted 253
2 SASI_Rn01_00036032 predicted 326
3 SASI_Rn01_00036033 predicted 673
4 SASI_Rn01_00036035 predicted 659
5 SASI_Rn01_00036036 predicted 691
6 SASI_Rn02_00201291 predicted 642
7 SASI_Rn02_00201292 predicted 550
8 SASI_Rn01_00036038 predicted 316
9 SASI_Rn02_00201293 predicted 678
10 SASI_Rn01_00036039 predicted 210
11 SASI_Rn01_00036031 predicted 557
12 SASI_Rn01_00036034 predicted 700
13 SASI_Rn01_00036037 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294186 predicted 274
2 SASI_Mm02_00294187 predicted 229
3 SASI_Mm02_00294188 predicted 484
4 SASI_Mm02_00294189 predicted 672
5 SASI_Mm02_00294190 predicted 336
6 SASI_Mm02_00294191 predicted 415
7 SASI_Mm02_00294192 predicted 573
8 SASI_Mm02_00294193 predicted 448
9 SASI_Mm02_00294194 predicted 328
10 SASI_Mm02_00294195 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210998 predicted 240
2 SASI_Mm01_00210999 predicted 266
3 SASI_Mm01_00211000 predicted 287
4 SASI_Mm01_00211001 predicted 310
5 SASI_Mm01_00211002 predicted 345
6 SASI_Mm01_00211003 predicted 340
7 SASI_Mm01_00211004 predicted 247
8 SASI_Mm01_00211005 predicted 294
9 SASI_Mm01_00211006 predicted 226
10 SASI_Mm01_00211007 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249275 predicted 536
2 SASI_Mm01_00249276 predicted 457
3 SASI_Mm01_00249277 predicted 651
4 SASI_Mm01_00249278 predicted 1340
5 SASI_Mm01_00249279 predicted 1396
6 SASI_Mm01_00249280 predicted 390
7 SASI_Mm01_00249281 predicted 1343
8 SASI_Mm01_00249282 predicted 1397
9 SASI_Mm01_00249283 predicted 544
10 SASI_Mm01_00249284 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203256 predicted 269
2 SASI_Mm01_00203257 predicted 557
3 SASI_Mm01_00203258 predicted 222
4 SASI_Mm01_00203259 predicted 482
5 SASI_Mm01_00203260 predicted 633
6 SASI_Mm01_00203261 predicted 748
7 SASI_Mm01_00203262 predicted 639
8 SASI_Mm01_00203263 predicted 414
9 SASI_Mm01_00203264 predicted 564
10 SASI_Mm01_00203265 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260622 predicted 520
2 SASI_Mm01_00260623 predicted 450
3 SASI_Mm01_00260624 predicted 638
4 SASI_Mm01_00260625 predicted 1329
5 SASI_Mm01_00260626 predicted 1374
6 SASI_Mm01_00260627 predicted 378
7 SASI_Mm01_00260628 predicted 1323
8 SASI_Mm01_00260629 predicted 1385
9 SASI_Mm01_00260630 predicted 523
10 SASI_Mm01_00260631 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017872
VALIDATED
THG1L MISSION shRNA Bacterial Glycerol Stock
tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-812s21c1
Sequence:CCGGATAATGAGCTGCCGATGTATACTCGAGTATACATCGGCAGCTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-409s21c1
Sequence:CCGGGAGGATATTGTGATCGCGTATCTCGAGATACGCGATCACAATATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-1034s21c1
Sequence:CCGGCTTCAGTTCTGGTGTGCTTAACTCGAGTTAAGCACACCAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-976s21c1
Sequence:CCGGGATGCTTTCTGGAAGGAACATCTCGAGATGTTCCTTCCAGAAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-181s1c1
Sequence:CCGGCGGAATTTCCATCGGTTTGCTCTCGAGAGCAAACCGATGGAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-853s1c1
Sequence:CCGGGATGCTTTCTGGAAGGAACATCTCGAGATGTTCCTTCCAGAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017872.2-577s1c1
Sequence:CCGGGCACTTATACAACAATCTGGACTCGAGTCCAGATTGTTGTATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-286s1c1
Sequence:CCGGGAGGATATTGTGATCGCGTATCTCGAGATACGCGATCACAATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-489s1c1
Sequence:CCGGGTATCCCAGCAACCAGACTTTCTCGAGAAAGTCTGGTTGCTGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017872.2-856s1c1
Sequence:CCGGGCTTTCTGGAAGGAACATCCACTCGAGTGGATGTTCCTTCCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-861s1c1
Sequence:CCGGCTGGAAGGAACATCCAGAGATCTCGAGATCTCTGGATGTTCCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017872
VALIDATED
THG1L MISSION shRNA shRNA Plasmid DNA
tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-812s21c1
Sequence:CCGGATAATGAGCTGCCGATGTATACTCGAGTATACATCGGCAGCTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-409s21c1
Sequence:CCGGGAGGATATTGTGATCGCGTATCTCGAGATACGCGATCACAATATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-1034s21c1
Sequence:CCGGCTTCAGTTCTGGTGTGCTTAACTCGAGTTAAGCACACCAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-976s21c1
Sequence:CCGGGATGCTTTCTGGAAGGAACATCTCGAGATGTTCCTTCCAGAAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-181s1c1
Sequence:CCGGCGGAATTTCCATCGGTTTGCTCTCGAGAGCAAACCGATGGAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-853s1c1
Sequence:CCGGGATGCTTTCTGGAAGGAACATCTCGAGATGTTCCTTCCAGAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017872.2-577s1c1
Sequence:CCGGGCACTTATACAACAATCTGGACTCGAGTCCAGATTGTTGTATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-286s1c1
Sequence:CCGGGAGGATATTGTGATCGCGTATCTCGAGATACGCGATCACAATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-489s1c1
Sequence:CCGGGTATCCCAGCAACCAGACTTTCTCGAGAAAGTCTGGTTGCTGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017872.2-856s1c1
Sequence:CCGGGCTTTCTGGAAGGAACATCCACTCGAGTGGATGTTCCTTCCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-861s1c1
Sequence:CCGGCTGGAAGGAACATCCAGAGATCTCGAGATCTCTGGATGTTCCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017872
VALIDATED
THG1L MISSION shRNA Lentiviral Transduction Particles
tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-812s21c1
Sequence:CCGGATAATGAGCTGCCGATGTATACTCGAGTATACATCGGCAGCTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-409s21c1
Sequence:CCGGGAGGATATTGTGATCGCGTATCTCGAGATACGCGATCACAATATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-1034s21c1
Sequence:CCGGCTTCAGTTCTGGTGTGCTTAACTCGAGTTAAGCACACCAGAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017872.3-976s21c1
Sequence:CCGGGATGCTTTCTGGAAGGAACATCTCGAGATGTTCCTTCCAGAAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-181s1c1
Sequence:CCGGCGGAATTTCCATCGGTTTGCTCTCGAGAGCAAACCGATGGAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-853s1c1
Sequence:CCGGGATGCTTTCTGGAAGGAACATCTCGAGATGTTCCTTCCAGAAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017872.2-577s1c1
Sequence:CCGGGCACTTATACAACAATCTGGACTCGAGTCCAGATTGTTGTATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-286s1c1
Sequence:CCGGGAGGATATTGTGATCGCGTATCTCGAGATACGCGATCACAATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-489s1c1
Sequence:CCGGGTATCCCAGCAACCAGACTTTCTCGAGAAAGTCTGGTTGCTGGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017872.2-856s1c1
Sequence:CCGGGCTTTCTGGAAGGAACATCCACTCGAGTGGATGTTCCTTCCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017872.2-861s1c1
Sequence:CCGGCTGGAAGGAACATCCAGAGATCTCGAGATCTCTGGATGTTCCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080969
THG1L MISSION shRNA Bacterial Glycerol Stock
tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-561s21c1
Sequence:CCGGGCAGACTGTCACATCAATAATCTCGAGATTATTGATGTGACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-131s21c1
Sequence:CCGGGTTTGAGTACGTGCGGAATTTCTCGAGAAATTCCGCACGTACTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-234s21c1
Sequence:CCGGCACAACTTTGCCAAACCTAATCTCGAGATTAGGTTTGGCAAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-425s21c1
Sequence:CCGGGTTTGCCTCCAGTTACGTATTCTCGAGAATACGTAACTGGAGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-667s21c1
Sequence:CCGGCGGCCGACAAGAATGAGATTCCTCGAGGAATCTCATTCTTGTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080969
THG1L MISSION shRNA shRNA Plasmid DNA
tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-561s21c1
Sequence:CCGGGCAGACTGTCACATCAATAATCTCGAGATTATTGATGTGACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-131s21c1
Sequence:CCGGGTTTGAGTACGTGCGGAATTTCTCGAGAAATTCCGCACGTACTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-234s21c1
Sequence:CCGGCACAACTTTGCCAAACCTAATCTCGAGATTAGGTTTGGCAAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-425s21c1
Sequence:CCGGGTTTGCCTCCAGTTACGTATTCTCGAGAATACGTAACTGGAGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-667s21c1
Sequence:CCGGCGGCCGACAAGAATGAGATTCCTCGAGGAATCTCATTCTTGTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080969
THG1L MISSION shRNA Lentiviral Transduction Particles
tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-561s21c1
Sequence:CCGGGCAGACTGTCACATCAATAATCTCGAGATTATTGATGTGACAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-131s21c1
Sequence:CCGGGTTTGAGTACGTGCGGAATTTCTCGAGAAATTCCGCACGTACTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-234s21c1
Sequence:CCGGCACAACTTTGCCAAACCTAATCTCGAGATTAGGTTTGGCAAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-425s21c1
Sequence:CCGGGTTTGCCTCCAGTTACGTATTCTCGAGAATACGTAACTGGAGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080969.2-667s21c1
Sequence:CCGGCGGCCGACAAGAATGAGATTCCTCGAGGAATCTCATTCTTGTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks