EMAIL THIS PAGE TO A FRIEND

THNSL1

threonine synthase-like 1 (S. cerevisiae)

Synonyms: TSH1
UniProtKB ID: Q8IYQ7, B3KWL1, D3DRV3, Q5VV21
Gene ID:
Mouse(208967) threonine synthase-like 1 (bacterial)
Rat(498805) threonine synthase-like 1 (S. cerevisiae)
chicken(420497) threonine synthase-like 1 (S. cerevisiae)
domestic cat(101081989) threonine synthase-like 1 (S. cerevisiae)
Horse(100055582) threonine synthase-like 1 (S. cerevisiae)
dog(477983) threonine synthase-like 1 (S. cerevisiae)
cow(788561) threonine synthase-like 1 (S. cerevisiae)
sheep(101105936) threonine synthase-like 1 (S. cerevisiae)
naked mole-rat(101699520) threonine synthase-like 1 (S. cerevisiae)
domestic guinea pig(100735703) threonine synthase-like 1 (S. cerevisiae)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024838 Rosetta Predictions human pricing
NM_001025035 Rosetta Predictions rat pricing
NM_001001297 Rosetta Predictions mouse pricing
NM_177588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177818 predicted 991
2 SASI_Hs01_00177820 predicted 788
3 SASI_Hs01_00177821 predicted 806
4 SASI_Hs02_00357406 predicted 2078
5 SASI_Hs01_00177822 predicted 910
6 SASI_Hs02_00357407 predicted 1413
7 SASI_Hs01_00177823 predicted 1784
8 SASI_Hs01_00177824 predicted 834
9 SASI_Hs02_00357408 predicted 2134
10 SASI_Hs01_00177826 predicted 1707
11 SASI_Hs01_00177817 predicted 1455
12 SASI_Hs01_00177819 predicted 644
13 SASI_Hs01_00177825 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072648 predicted 1879
2 SASI_Rn01_00072649 predicted 387
3 SASI_Rn01_00072650 predicted 2281
4 SASI_Rn01_00072651 predicted 833
5 SASI_Rn01_00072653 predicted 1467
6 SASI_Rn01_00072654 predicted 1262
7 SASI_Rn01_00072655 predicted 1735
8 SASI_Rn01_00072656 predicted 2065
9 SASI_Rn01_00072657 predicted 1522
10 SASI_Rn02_00202947 predicted 822
11 SASI_Rn01_00072652 predicted 2258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079869 predicted 627
2 SASI_Mm01_00079871 predicted 613
3 SASI_Mm01_00079872 predicted 640
4 SASI_Mm01_00079873 predicted 1022
5 SASI_Mm01_00079874 predicted 1218
6 SASI_Mm01_00079875 predicted 637
7 SASI_Mm01_00079876 predicted 1212
8 SASI_Mm01_00079877 predicted 488
9 SASI_Mm01_00079878 predicted 670
10 SASI_Mm02_00286113 predicted 905
11 SASI_Mm01_00079870 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099565 predicted 2195
2 SASI_Mm01_00099567 predicted 2182
3 SASI_Mm01_00099568 predicted 2215
4 SASI_Mm01_00099569 predicted 2594
5 SASI_Mm01_00099570 predicted 2795
6 SASI_Mm01_00099571 predicted 2209
7 SASI_Mm01_00099572 predicted 2793
8 SASI_Mm01_00099573 predicted 2057
9 SASI_Mm01_00099574 predicted 2245
10 SASI_Mm02_00347766 predicted 2473
11 SASI_Mm01_00099566 predicted 2717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024838
VALIDATED
THNSL1 MISSION shRNA Bacterial Glycerol Stock
threonine synthase-like 1 (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-1704s1c1
Sequence:CCGGCCGCATATCTTGATCTTGTTACTCGAGTAACAAGATCAAGATATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-324s1c1
Sequence:CCGGCGGATAAACATGCACAGCGATCTCGAGATCGCTGTGCATGTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-2223s1c1
Sequence:CCGGGCCCTGTGATTATCTCATCTACTCGAGTAGATGAGATAATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-2332s1c1
Sequence:CCGGGCTGGGTTCATACAATGCATTCTCGAGAATGCATTGTATGAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024838.3-2126s1c1
Sequence:CCGGGCAGCTATTAACTCCACCTATCTCGAGATAGGTGGAGTTAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-2348s21c1
Sequence:GTACCGGTGCTATCATGCAGGCTTTAAACTCGAGTTTAAAGCCTGCATGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024838.4-2869s21c1
Sequence:CCGGGTATACTATTTGGCGATTAAACTCGAGTTTAATCGCCAAATAGTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-2208s21c1
Sequence:CCGGGCTATTAACTCCACCTATAATCTCGAGATTATAGGTGGAGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-1393s21c1
Sequence:CCGGTACAGCTTATGCCTCATATTTCTCGAGAAATATGAGGCATAAGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-795s21c1
Sequence:CCGGGTACCTCTACTAGATCTAATTCTCGAGAATTAGATCTAGTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024838
VALIDATED
THNSL1 MISSION shRNA shRNA Plasmid DNA
threonine synthase-like 1 (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-1704s1c1
Sequence:CCGGCCGCATATCTTGATCTTGTTACTCGAGTAACAAGATCAAGATATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-324s1c1
Sequence:CCGGCGGATAAACATGCACAGCGATCTCGAGATCGCTGTGCATGTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-2223s1c1
Sequence:CCGGGCCCTGTGATTATCTCATCTACTCGAGTAGATGAGATAATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-2332s1c1
Sequence:CCGGGCTGGGTTCATACAATGCATTCTCGAGAATGCATTGTATGAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024838.3-2126s1c1
Sequence:CCGGGCAGCTATTAACTCCACCTATCTCGAGATAGGTGGAGTTAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-2348s21c1
Sequence:GTACCGGTGCTATCATGCAGGCTTTAAACTCGAGTTTAAAGCCTGCATGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024838.4-2869s21c1
Sequence:CCGGGTATACTATTTGGCGATTAAACTCGAGTTTAATCGCCAAATAGTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-2208s21c1
Sequence:CCGGGCTATTAACTCCACCTATAATCTCGAGATTATAGGTGGAGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-1393s21c1
Sequence:CCGGTACAGCTTATGCCTCATATTTCTCGAGAAATATGAGGCATAAGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-795s21c1
Sequence:CCGGGTACCTCTACTAGATCTAATTCTCGAGAATTAGATCTAGTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024838
VALIDATED
THNSL1 MISSION shRNA Lentiviral Transduction Particles
threonine synthase-like 1 (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-1704s1c1
Sequence:CCGGCCGCATATCTTGATCTTGTTACTCGAGTAACAAGATCAAGATATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-324s1c1
Sequence:CCGGCGGATAAACATGCACAGCGATCTCGAGATCGCTGTGCATGTTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-2223s1c1
Sequence:CCGGGCCCTGTGATTATCTCATCTACTCGAGTAGATGAGATAATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024838.3-2332s1c1
Sequence:CCGGGCTGGGTTCATACAATGCATTCTCGAGAATGCATTGTATGAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024838.3-2126s1c1
Sequence:CCGGGCAGCTATTAACTCCACCTATCTCGAGATAGGTGGAGTTAATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-2348s21c1
Sequence:GTACCGGTGCTATCATGCAGGCTTTAAACTCGAGTTTAAAGCCTGCATGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024838.4-2869s21c1
Sequence:CCGGGTATACTATTTGGCGATTAAACTCGAGTTTAATCGCCAAATAGTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-2208s21c1
Sequence:CCGGGCTATTAACTCCACCTATAATCTCGAGATTATAGGTGGAGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-1393s21c1
Sequence:CCGGTACAGCTTATGCCTCATATTTCTCGAGAAATATGAGGCATAAGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024838.4-795s21c1
Sequence:CCGGGTACCTCTACTAGATCTAATTCTCGAGAATTAGATCTAGTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177588
VALIDATED
THNSL1 MISSION shRNA Bacterial Glycerol Stock
threonine synthase-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-2065s1c1
Sequence:CCGGGCTAACAAAGACGGACAGTTACTCGAGTAACTGTCCGTCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-2074s1c1
Sequence:CCGGGACGGACAGTTAATGGCAAATCTCGAGATTTGCCATTAACTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177588.1-1924s1c1
Sequence:CCGGGCCTCTAATCAGAACCACGTTCTCGAGAACGTGGTTCTGATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-891s1c1
Sequence:CCGGCGTAAGACTGTACTATAAGAACTCGAGTTCTTATAGTACAGTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177588.1-888s1c1
Sequence:CCGGGCACGTAAGACTGTACTATAACTCGAGTTATAGTACAGTCTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-1702s21c1
Sequence:CCGGTGGAATATGGAACAATCTTAACTCGAGTTAAGATTGTTCCATATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177588.2-2837s21c1
Sequence:CCGGGTGCTGCATATCTAGTCATTTCTCGAGAAATGACTAGATATGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-1751s21c1
Sequence:CCGGACTACTTCCGCAGATAGTTTACTCGAGTAAACTATCTGCGGAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-2221s21c1
Sequence:CCGGACAATGCATCAGGCTATATTTCTCGAGAAATATAGCCTGATGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177588
VALIDATED
THNSL1 MISSION shRNA shRNA Plasmid DNA
threonine synthase-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-2065s1c1
Sequence:CCGGGCTAACAAAGACGGACAGTTACTCGAGTAACTGTCCGTCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-2074s1c1
Sequence:CCGGGACGGACAGTTAATGGCAAATCTCGAGATTTGCCATTAACTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177588.1-1924s1c1
Sequence:CCGGGCCTCTAATCAGAACCACGTTCTCGAGAACGTGGTTCTGATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-891s1c1
Sequence:CCGGCGTAAGACTGTACTATAAGAACTCGAGTTCTTATAGTACAGTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177588.1-888s1c1
Sequence:CCGGGCACGTAAGACTGTACTATAACTCGAGTTATAGTACAGTCTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-1702s21c1
Sequence:CCGGTGGAATATGGAACAATCTTAACTCGAGTTAAGATTGTTCCATATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177588.2-2837s21c1
Sequence:CCGGGTGCTGCATATCTAGTCATTTCTCGAGAAATGACTAGATATGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-1751s21c1
Sequence:CCGGACTACTTCCGCAGATAGTTTACTCGAGTAAACTATCTGCGGAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-2221s21c1
Sequence:CCGGACAATGCATCAGGCTATATTTCTCGAGAAATATAGCCTGATGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177588
VALIDATED
THNSL1 MISSION shRNA Lentiviral Transduction Particles
threonine synthase-like 1 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-2065s1c1
Sequence:CCGGGCTAACAAAGACGGACAGTTACTCGAGTAACTGTCCGTCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-2074s1c1
Sequence:CCGGGACGGACAGTTAATGGCAAATCTCGAGATTTGCCATTAACTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177588.1-1924s1c1
Sequence:CCGGGCCTCTAATCAGAACCACGTTCTCGAGAACGTGGTTCTGATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177588.1-891s1c1
Sequence:CCGGCGTAAGACTGTACTATAAGAACTCGAGTTCTTATAGTACAGTCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_177588.1-888s1c1
Sequence:CCGGGCACGTAAGACTGTACTATAACTCGAGTTATAGTACAGTCTTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-1702s21c1
Sequence:CCGGTGGAATATGGAACAATCTTAACTCGAGTTAAGATTGTTCCATATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177588.2-2837s21c1
Sequence:CCGGGTGCTGCATATCTAGTCATTTCTCGAGAAATGACTAGATATGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-1751s21c1
Sequence:CCGGACTACTTCCGCAGATAGTTTACTCGAGTAAACTATCTGCGGAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177588.2-2221s21c1
Sequence:CCGGACAATGCATCAGGCTATATTTCTCGAGAAATATAGCCTGATGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks