EMAIL THIS PAGE TO A FRIEND

THNSL2

threonine synthase-like 2 (S. cerevisiae)

Synonyms: SOFAT THS2 TSH2
Gene ID:
Human(55258) Summary: This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(232078) threonine synthase-like 2 (bacterial)
Rat(297332) threonine synthase-like 2 (S. cerevisiae)
domestic guinea pig(100724650) threonine synthase-like 2 (S. cerevisiae)
naked mole-rat(101714603) threonine synthase-like 2 (S. cerevisiae)
cow(541205) threonine synthase-like 2 (S. cerevisiae)
sheep(101109256) threonine synthase-like 2 (S. cerevisiae)
Zebrafish(641568) threonine synthase-like 2 (S. cerevisiae)
Horse(100066561) threonine synthase-like 2 (S. cerevisiae)
domestic cat(101095735) threonine synthase-like 2 (S. cerevisiae)
dog(475757) threonine synthase-like 2 (S. cerevisiae)
chicken(422927) threonine synthase-like 2 (S. cerevisiae)
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018271 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075531 MISSION® esiRNA esiRNA human THNSL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018271 Rosetta Predictions human pricing
NM_001009658 Rosetta Predictions rat pricing
NM_001033929 Rosetta Predictions mouse pricing
NM_178413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124716 predicted 1172
2 SASI_Hs02_00351639 predicted 1345
3 SASI_Hs01_00124717 predicted 1196
4 SASI_Hs01_00124718 predicted 994
5 SASI_Hs01_00124719 predicted 610
6 SASI_Hs02_00351640 predicted 1224
7 SASI_Hs01_00124721 predicted 798
8 SASI_Hs02_00351641 predicted 1100
9 SASI_Hs01_00124720 predicted 1094
10 SASI_Hs01_00124722 predicted 656
11 SASI_Hs01_00124723 predicted 313
12 SASI_Hs01_00124724 predicted 715
13 SASI_Hs01_00124725 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059216 predicted 1132
2 SASI_Rn01_00059217 predicted 498
3 SASI_Rn01_00059218 predicted 348
4 SASI_Rn01_00059219 predicted 1137
5 SASI_Rn02_00199686 predicted 868
6 SASI_Rn01_00059221 predicted 991
7 SASI_Rn01_00059222 predicted 1485
8 SASI_Rn01_00059223 predicted 251
9 SASI_Rn01_00059224 predicted 298
10 SASI_Rn02_00199687 predicted 334
11 SASI_Rn01_00059220 predicted 414
12 SASI_Rn01_00059225 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135916 predicted 541
2 SASI_Mm01_00135918 predicted 706
3 SASI_Mm01_00135919 predicted 342
4 SASI_Mm01_00135920 predicted 386
5 SASI_Mm01_00135921 predicted 657
6 SASI_Mm01_00135922 predicted 1046
7 SASI_Mm01_00135923 predicted 908
8 SASI_Mm01_00135924 predicted 289
9 SASI_Mm01_00135925 predicted 318
10 SASI_Mm02_00289041 predicted 372
11 SASI_Mm01_00135917 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150604 predicted 612
2 SASI_Mm01_00150606 predicted 778
3 SASI_Mm01_00150607 predicted 403
4 SASI_Mm01_00150608 predicted 457
5 SASI_Mm01_00150609 predicted 726
6 SASI_Mm01_00150610 predicted 1116
7 SASI_Mm01_00150611 predicted 973
8 SASI_Mm01_00150612 predicted 357
9 SASI_Mm01_00150613 predicted 384
10 SASI_Mm02_00348868 predicted 441
11 SASI_Mm01_00150605 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178413
VALIDATED
THNSL2 MISSION shRNA Bacterial Glycerol Stock
threonine synthase-like 2 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1349s21c1
Sequence:CCGGACAGCGGTGAACTACCATTACCTCGAGGTAATGGTAGTTCACCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1020s21c1
Sequence:CCGGTGAACCGCAACGACATCATTCCTCGAGGAATGATGTCGTTGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1619s21c1
Sequence:CCGGCCAGGCTGGAATGGGATTGAACTCGAGTTCAATCCCATTCCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1219s21c1
Sequence:CCGGGCTACCCAAGGACCTACATAACTCGAGTTATGTAGGTCCTTGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-865s21c1
Sequence:CCGGACACCACTTCTTCGCTTATTTCTCGAGAAATAAGCGAAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-693s21c1
Sequence:CCGGTCCAGATGACAACGGTGTTAACTCGAGTTAACACCGTTGTCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178413.4-1664s21c1
Sequence:CCGGGACAAGATGTCTCAGTAGTTACTCGAGTAACTACTGAGACATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-775s1c1
Sequence:CCGGGCACAACGTGATGAGCTTGAACTCGAGTTCAAGCTCATCACGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178413.3-1640s1c1
Sequence:CCGGGCTCAGTAGTTAGGAACTCTTCTCGAGAAGAGTTCCTAACTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-331s1c1
Sequence:CCGGGCTTATTCCAAGACATGACTTCTCGAGAAGTCATGTCTTGGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178413.3-1552s1c1
Sequence:CCGGGTGGAAAGATTGTGTAGTGAACTCGAGTTCACTACACAATCTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-575s1c1
Sequence:CCGGGCTGCCATTGAGAGTGTTCAACTCGAGTTGAACACTCTCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178413
VALIDATED
THNSL2 MISSION shRNA shRNA Plasmid DNA
threonine synthase-like 2 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1349s21c1
Sequence:CCGGACAGCGGTGAACTACCATTACCTCGAGGTAATGGTAGTTCACCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1020s21c1
Sequence:CCGGTGAACCGCAACGACATCATTCCTCGAGGAATGATGTCGTTGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1619s21c1
Sequence:CCGGCCAGGCTGGAATGGGATTGAACTCGAGTTCAATCCCATTCCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1219s21c1
Sequence:CCGGGCTACCCAAGGACCTACATAACTCGAGTTATGTAGGTCCTTGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-865s21c1
Sequence:CCGGACACCACTTCTTCGCTTATTTCTCGAGAAATAAGCGAAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-693s21c1
Sequence:CCGGTCCAGATGACAACGGTGTTAACTCGAGTTAACACCGTTGTCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178413.4-1664s21c1
Sequence:CCGGGACAAGATGTCTCAGTAGTTACTCGAGTAACTACTGAGACATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-775s1c1
Sequence:CCGGGCACAACGTGATGAGCTTGAACTCGAGTTCAAGCTCATCACGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178413.3-1640s1c1
Sequence:CCGGGCTCAGTAGTTAGGAACTCTTCTCGAGAAGAGTTCCTAACTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-331s1c1
Sequence:CCGGGCTTATTCCAAGACATGACTTCTCGAGAAGTCATGTCTTGGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178413.3-1552s1c1
Sequence:CCGGGTGGAAAGATTGTGTAGTGAACTCGAGTTCACTACACAATCTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-575s1c1
Sequence:CCGGGCTGCCATTGAGAGTGTTCAACTCGAGTTGAACACTCTCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178413
VALIDATED
THNSL2 MISSION shRNA Lentiviral Transduction Particles
threonine synthase-like 2 (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1349s21c1
Sequence:CCGGACAGCGGTGAACTACCATTACCTCGAGGTAATGGTAGTTCACCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1020s21c1
Sequence:CCGGTGAACCGCAACGACATCATTCCTCGAGGAATGATGTCGTTGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1619s21c1
Sequence:CCGGCCAGGCTGGAATGGGATTGAACTCGAGTTCAATCCCATTCCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-1219s21c1
Sequence:CCGGGCTACCCAAGGACCTACATAACTCGAGTTATGTAGGTCCTTGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-865s21c1
Sequence:CCGGACACCACTTCTTCGCTTATTTCTCGAGAAATAAGCGAAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178413.4-693s21c1
Sequence:CCGGTCCAGATGACAACGGTGTTAACTCGAGTTAACACCGTTGTCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178413.4-1664s21c1
Sequence:CCGGGACAAGATGTCTCAGTAGTTACTCGAGTAACTACTGAGACATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-775s1c1
Sequence:CCGGGCACAACGTGATGAGCTTGAACTCGAGTTCAAGCTCATCACGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178413.3-1640s1c1
Sequence:CCGGGCTCAGTAGTTAGGAACTCTTCTCGAGAAGAGTTCCTAACTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-331s1c1
Sequence:CCGGGCTTATTCCAAGACATGACTTCTCGAGAAGTCATGTCTTGGAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178413.3-1552s1c1
Sequence:CCGGGTGGAAAGATTGTGTAGTGAACTCGAGTTCACTACACAATCTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178413.3-575s1c1
Sequence:CCGGGCTGCCATTGAGAGTGTTCAACTCGAGTTGAACACTCTCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018271
THNSL2 MISSION shRNA Bacterial Glycerol Stock
threonine synthase-like 2 (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-713s1c1
Sequence:CCGGGCACAATCTGATGAGCCTGAACTCGAGTTCAGGCTCATCAGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018271.2-1807s1c1
Sequence:CCGGGAAAGTTTCAGGGCCTGCAAACTCGAGTTTGCAGGCCCTGAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1465s1c1
Sequence:CCGGGACAACTGGATGCTGATGCTTCTCGAGAAGCATCAGCATCCAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-513s1c1
Sequence:CCGGGCTGCCATTGAGAGTGTTCAACTCGAGTTGAACACTCTCAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-984s1c1
Sequence:CCGGGCTGTTAAATCAACCTTGGCACTCGAGTGCCAAGGTTGATTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-714s1c1
Sequence:CCGGCACAATCTGATGAGCCTGAATCTCGAGATTCAGGCTCATCAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-985s1c1
Sequence:CCGGCTGTTAAATCAACCTTGGCATCTCGAGATGCCAAGGTTGATTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-569s1c1
Sequence:CCGGCAAAGGTCACTGCACAAAGATCTCGAGATCTTTGTGCAGTGACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161914    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018271.2-1793s1c1
Sequence:CCGGGTCTGAGCTGTAGTGAAAGTTCTCGAGAACTTTCACTACAGCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1112s1c1
Sequence:CCGGCCAAAGTGTGAATCTGCCCAACTCGAGTTGGGCAGATTCACACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-669s1c1
Sequence:CCGGGAGCCGATCAAGACTGTGTTTCTCGAGAAACACAGTCTTGATCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1095s1c1
Sequence:CCGGGAGCAGTTTGAAAGGACCCAACTCGAGTTGGGTCCTTTCAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018271
THNSL2 MISSION shRNA shRNA Plasmid DNA
threonine synthase-like 2 (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-713s1c1
Sequence:CCGGGCACAATCTGATGAGCCTGAACTCGAGTTCAGGCTCATCAGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018271.2-1807s1c1
Sequence:CCGGGAAAGTTTCAGGGCCTGCAAACTCGAGTTTGCAGGCCCTGAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1465s1c1
Sequence:CCGGGACAACTGGATGCTGATGCTTCTCGAGAAGCATCAGCATCCAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-513s1c1
Sequence:CCGGGCTGCCATTGAGAGTGTTCAACTCGAGTTGAACACTCTCAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-984s1c1
Sequence:CCGGGCTGTTAAATCAACCTTGGCACTCGAGTGCCAAGGTTGATTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-714s1c1
Sequence:CCGGCACAATCTGATGAGCCTGAATCTCGAGATTCAGGCTCATCAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-985s1c1
Sequence:CCGGCTGTTAAATCAACCTTGGCATCTCGAGATGCCAAGGTTGATTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-569s1c1
Sequence:CCGGCAAAGGTCACTGCACAAAGATCTCGAGATCTTTGTGCAGTGACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161914    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018271.2-1793s1c1
Sequence:CCGGGTCTGAGCTGTAGTGAAAGTTCTCGAGAACTTTCACTACAGCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1112s1c1
Sequence:CCGGCCAAAGTGTGAATCTGCCCAACTCGAGTTGGGCAGATTCACACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-669s1c1
Sequence:CCGGGAGCCGATCAAGACTGTGTTTCTCGAGAAACACAGTCTTGATCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1095s1c1
Sequence:CCGGGAGCAGTTTGAAAGGACCCAACTCGAGTTGGGTCCTTTCAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018271
THNSL2 MISSION shRNA Lentiviral Transduction Particles
threonine synthase-like 2 (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-713s1c1
Sequence:CCGGGCACAATCTGATGAGCCTGAACTCGAGTTCAGGCTCATCAGATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018271.2-1807s1c1
Sequence:CCGGGAAAGTTTCAGGGCCTGCAAACTCGAGTTTGCAGGCCCTGAAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1465s1c1
Sequence:CCGGGACAACTGGATGCTGATGCTTCTCGAGAAGCATCAGCATCCAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-513s1c1
Sequence:CCGGGCTGCCATTGAGAGTGTTCAACTCGAGTTGAACACTCTCAATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-984s1c1
Sequence:CCGGGCTGTTAAATCAACCTTGGCACTCGAGTGCCAAGGTTGATTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-714s1c1
Sequence:CCGGCACAATCTGATGAGCCTGAATCTCGAGATTCAGGCTCATCAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-985s1c1
Sequence:CCGGCTGTTAAATCAACCTTGGCATCTCGAGATGCCAAGGTTGATTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-569s1c1
Sequence:CCGGCAAAGGTCACTGCACAAAGATCTCGAGATCTTTGTGCAGTGACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161914    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018271.2-1793s1c1
Sequence:CCGGGTCTGAGCTGTAGTGAAAGTTCTCGAGAACTTTCACTACAGCTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1112s1c1
Sequence:CCGGCCAAAGTGTGAATCTGCCCAACTCGAGTTGGGCAGATTCACACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-669s1c1
Sequence:CCGGGAGCCGATCAAGACTGTGTTTCTCGAGAAACACAGTCTTGATCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018271.2-1095s1c1
Sequence:CCGGGAGCAGTTTGAAAGGACCCAACTCGAGTTGGGTCCTTTCAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks