EMAIL THIS PAGE TO A FRIEND

THOC1

THO complex 1

Synonyms: HPR1 P84 P84N5
UniProtKB ID: Q96FV9, B2RBP6, Q15219, Q64I72, Q64I73
Gene ID:
Human(9984) Summary: HPR1 is part of the TREX (transcription/export) complex, which includes TEX1 (MIM 606929), THO2 (MIM 300395), ALY (MIM 604171), and UAP56 (MIM 142560).[supplied by OMIM, Nov 2010]
Mouse(225160) THO complex 1
Rat(291797) THO complex 1
Zebrafish(373077) THO complex 1
chicken(421062) THO complex 1
dog(490529) THO complex 1
Horse(100051155) THO complex 1
domestic cat(101094299) THO complex 1
cow(100138748) THO complex 1
sheep(101121992) THO complex 1
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40578 Anti-THOC1 antibody produced in rabbit affinity isolated antibody mouse, human, rat, horse, bovine, guinea pig, canine, rabbit
western blot pricing
HPA019096 Anti-THOC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA019687 Anti-THOC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701984 Anti-THOC1 antibody produced in rabbit human
immunohistochemistry, western blot pricing
SAB2702154 Monoclonal Anti-THOC1 antibody produced in mouse rat, mouse, human, monkey
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005131 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005131 Rosetta Predictions human pricing
NM_001047850 Rosetta Predictions rat pricing
XM_214625 Rosetta Predictions rat pricing
NM_153552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103117 predicted 1417
2 SASI_Hs01_00103118 predicted 1082
3 SASI_Hs02_00339049 predicted 1524
4 SASI_Hs01_00103123 predicted 665
5 SASI_Hs02_00339050 predicted 1492
6 SASI_Hs01_00103119 predicted 1090
7 SASI_Hs02_00339051 predicted 1349
8 SASI_Hs01_00103121 predicted 1238
9 SASI_Hs01_00103122 predicted 542
10 SASI_Hs01_00103126 predicted 720
11 SASI_Hs01_00103120 predicted 1544
12 SASI_Hs01_00103124 predicted 1507
13 SASI_Hs01_00103125 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206175 predicted 403
2 SASI_Rn02_00206176 predicted 1202
3 SASI_Rn02_00206177 predicted 1244
4 SASI_Rn02_00206178 predicted 474
5 SASI_Rn02_00206179 predicted 616
6 SASI_Rn02_00206180 predicted 455
7 SASI_Rn02_00206181 predicted 382
8 SASI_Rn02_00206182 predicted 655
9 SASI_Rn02_00206183 predicted 851
10 SASI_Rn02_00206184 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134571 predicted 1711
2 SASI_Rn01_00134572 predicted 1327
3 SASI_Rn01_00134573 predicted 1319
4 SASI_Rn01_00134574 predicted 1279
5 SASI_Rn01_00134575 predicted 1571
6 SASI_Rn01_00134576 predicted 1710
7 SASI_Rn01_00134577 predicted 1757
8 SASI_Rn01_00134578 predicted 1131
9 SASI_Rn01_00134579 predicted 1196
10 SASI_Rn01_00134580 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021509 predicted 1462
2 SASI_Mm01_00021510 predicted 367
3 SASI_Mm01_00021511 predicted 1658
4 SASI_Mm02_00343330 predicted 1915
5 SASI_Mm01_00021514 predicted 1889
6 SASI_Mm01_00021515 predicted 1328
7 SASI_Mm01_00021516 predicted 1390
8 SASI_Mm01_00021517 predicted 1540
9 SASI_Mm02_00343331 predicted 455
10 SASI_Mm02_00343332 predicted 1047
11 SASI_Mm01_00021512 predicted 1461
12 SASI_Mm01_00021513 predicted 521
13 SASI_Mm01_00021518 predicted 1922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153552
VALIDATED
THOC1 MISSION shRNA Bacterial Glycerol Stock
THO complex 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153552.2-3172s1c1
Sequence:CCGGGCACTGTTTCATTCCATGTTTCTCGAGAAACATGGAATGAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1779s1c1
Sequence:CCGGGCTCCTTACCTGGAAATTAAACTCGAGTTTAATTTCCAGGTAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1920s1c1
Sequence:CCGGGCACTAAACAAGTCTGGATTACTCGAGTAATCCAGACTTGTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1655s1c1
Sequence:CCGGCGAGGAAGATAATGATGCTTTCTCGAGAAAGCATCATTATCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-755s1c1
Sequence:CCGGCCCAGTGCAATGCTATGAGAACTCGAGTTCTCATAGCATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-1458s21c1
Sequence:CCGGGTGAATATAAAGCCGTAAATACTCGAGTATTTACGGCTTTATATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-1778s21c1
Sequence:CCGGGCTCCTTACCTGGAAATTAAACTCGAGTTTAATTTCCAGGTAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153552.3-1919s21c1
Sequence:CCGGGCACTAAACAAGTCTGGATTACTCGAGTAATCCAGACTTGTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-754s21c1
Sequence:CCGGCCCAGTGCAATGCTATGAGAACTCGAGTTCTCATAGCATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153552
VALIDATED
THOC1 MISSION shRNA shRNA Plasmid DNA
THO complex 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153552.2-3172s1c1
Sequence:CCGGGCACTGTTTCATTCCATGTTTCTCGAGAAACATGGAATGAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1779s1c1
Sequence:CCGGGCTCCTTACCTGGAAATTAAACTCGAGTTTAATTTCCAGGTAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1920s1c1
Sequence:CCGGGCACTAAACAAGTCTGGATTACTCGAGTAATCCAGACTTGTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1655s1c1
Sequence:CCGGCGAGGAAGATAATGATGCTTTCTCGAGAAAGCATCATTATCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-755s1c1
Sequence:CCGGCCCAGTGCAATGCTATGAGAACTCGAGTTCTCATAGCATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-1458s21c1
Sequence:CCGGGTGAATATAAAGCCGTAAATACTCGAGTATTTACGGCTTTATATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-1778s21c1
Sequence:CCGGGCTCCTTACCTGGAAATTAAACTCGAGTTTAATTTCCAGGTAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153552.3-1919s21c1
Sequence:CCGGGCACTAAACAAGTCTGGATTACTCGAGTAATCCAGACTTGTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-754s21c1
Sequence:CCGGCCCAGTGCAATGCTATGAGAACTCGAGTTCTCATAGCATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153552
VALIDATED
THOC1 MISSION shRNA Lentiviral Transduction Particles
THO complex 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153552.2-3172s1c1
Sequence:CCGGGCACTGTTTCATTCCATGTTTCTCGAGAAACATGGAATGAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1779s1c1
Sequence:CCGGGCTCCTTACCTGGAAATTAAACTCGAGTTTAATTTCCAGGTAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1920s1c1
Sequence:CCGGGCACTAAACAAGTCTGGATTACTCGAGTAATCCAGACTTGTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-1655s1c1
Sequence:CCGGCGAGGAAGATAATGATGCTTTCTCGAGAAAGCATCATTATCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153552.2-755s1c1
Sequence:CCGGCCCAGTGCAATGCTATGAGAACTCGAGTTCTCATAGCATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-1458s21c1
Sequence:CCGGGTGAATATAAAGCCGTAAATACTCGAGTATTTACGGCTTTATATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-1778s21c1
Sequence:CCGGGCTCCTTACCTGGAAATTAAACTCGAGTTTAATTTCCAGGTAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153552.3-1919s21c1
Sequence:CCGGGCACTAAACAAGTCTGGATTACTCGAGTAATCCAGACTTGTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153552.3-754s21c1
Sequence:CCGGCCCAGTGCAATGCTATGAGAACTCGAGTTCTCATAGCATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005131
VALIDATED
THOC1 MISSION shRNA Bacterial Glycerol Stock
THO complex 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-2046s1c1
Sequence:CCGGTGATAAGAGGTCCACTGGTTTCTCGAGAAACCAGTGGACCTCTTATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-1229s1c1
Sequence:CCGGAGATACCAAACCTACGAGAATCTCGAGATTCTCGTAGGTTTGGTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005131.x-1309s1c1
Sequence:CCGGTGACGGGAAATGAGGAGTTAACTCGAGTTAACTCCTCATTTCCCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-1799s1c1
Sequence:CCGGAGACTCAGAAATTAGGCAGATCTCGAGATCTGCCTAATTTCTGAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005131.x-427s1c1
Sequence:CCGGGTATGTGCAATGATCTCCTAACTCGAGTTAGGAGATCATTGCACATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005131.2-2072s21c1
Sequence:CCGGTGATAAGAGGTCCACTGGTTTCTCGAGAAACCAGTGGACCTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005131.2-283s21c1
Sequence:CCGGGGGAGTAACTGAAGGTATTTGCTCGAGCAAATACCTTCAGTTACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-1164s21c1
Sequence:CCGGCAAAGATGGTAGAGCATATATCTCGAGATATATGCTCTACCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-1825s21c1
Sequence:CCGGAGACTCAGAAATTAGGCAGATCTCGAGATCTGCCTAATTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-715s21c1
Sequence:CCGGGTGCTCTATTCCAATTGATTACTCGAGTAATCAATTGGAATAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005131
VALIDATED
THOC1 MISSION shRNA shRNA Plasmid DNA
THO complex 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-2046s1c1
Sequence:CCGGTGATAAGAGGTCCACTGGTTTCTCGAGAAACCAGTGGACCTCTTATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-1229s1c1
Sequence:CCGGAGATACCAAACCTACGAGAATCTCGAGATTCTCGTAGGTTTGGTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005131.x-1309s1c1
Sequence:CCGGTGACGGGAAATGAGGAGTTAACTCGAGTTAACTCCTCATTTCCCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-1799s1c1
Sequence:CCGGAGACTCAGAAATTAGGCAGATCTCGAGATCTGCCTAATTTCTGAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005131.x-427s1c1
Sequence:CCGGGTATGTGCAATGATCTCCTAACTCGAGTTAGGAGATCATTGCACATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005131.2-2072s21c1
Sequence:CCGGTGATAAGAGGTCCACTGGTTTCTCGAGAAACCAGTGGACCTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005131.2-283s21c1
Sequence:CCGGGGGAGTAACTGAAGGTATTTGCTCGAGCAAATACCTTCAGTTACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-1164s21c1
Sequence:CCGGCAAAGATGGTAGAGCATATATCTCGAGATATATGCTCTACCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-1825s21c1
Sequence:CCGGAGACTCAGAAATTAGGCAGATCTCGAGATCTGCCTAATTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-715s21c1
Sequence:CCGGGTGCTCTATTCCAATTGATTACTCGAGTAATCAATTGGAATAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005131
VALIDATED
THOC1 MISSION shRNA Lentiviral Transduction Particles
THO complex 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-2046s1c1
Sequence:CCGGTGATAAGAGGTCCACTGGTTTCTCGAGAAACCAGTGGACCTCTTATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-1229s1c1
Sequence:CCGGAGATACCAAACCTACGAGAATCTCGAGATTCTCGTAGGTTTGGTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005131.x-1309s1c1
Sequence:CCGGTGACGGGAAATGAGGAGTTAACTCGAGTTAACTCCTCATTTCCCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005131.x-1799s1c1
Sequence:CCGGAGACTCAGAAATTAGGCAGATCTCGAGATCTGCCTAATTTCTGAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005131.x-427s1c1
Sequence:CCGGGTATGTGCAATGATCTCCTAACTCGAGTTAGGAGATCATTGCACATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005131.2-2072s21c1
Sequence:CCGGTGATAAGAGGTCCACTGGTTTCTCGAGAAACCAGTGGACCTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005131.2-283s21c1
Sequence:CCGGGGGAGTAACTGAAGGTATTTGCTCGAGCAAATACCTTCAGTTACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-1164s21c1
Sequence:CCGGCAAAGATGGTAGAGCATATATCTCGAGATATATGCTCTACCATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-1825s21c1
Sequence:CCGGAGACTCAGAAATTAGGCAGATCTCGAGATCTGCCTAATTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005131.2-715s21c1
Sequence:CCGGGTGCTCTATTCCAATTGATTACTCGAGTAATCAATTGGAATAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks