EMAIL THIS PAGE TO A FRIEND

THOC2

THO complex 2

Synonyms: CXorf3 THO2 dJ506G2.1 hTREX120
UniProtKB ID: Q8NI27, A6NM50, Q5JZ12, Q6IN92, Q9H8I6
Gene ID:
Human(57187) Summary: The TREX multiprotein complex binds specifically to spliced mRNAs to facilitate mRNA export. The protein encoded by this gene is a member of the THO complex, a subset of the TREX complex. The encoded protein interacts with the THOC1 protein.[provided by RefSeq, Jun 2010]
Mouse(331401) THO complex 2
Rat(313308) THO complex 2
cow(507738) THO complex 2
sheep(101123613) THO complex 2
Zebrafish(368417) THO complex 2
chicken(422361) THO complex 2
dog(481042) THO complex 2
Horse(100055091) THO complex 2
domestic cat(101090337) THO complex 2
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047921 Anti-THOC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001081550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001081550 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_047325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_047325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_047325 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145541 MISSION® esiRNA esiRNA human THOC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081550 Rosetta Predictions human pricing
NM_020449 Rosetta Predictions human pricing
XM_001058768 Rosetta Predictions rat pricing
XM_233081 Rosetta Predictions rat pricing
NM_001033422 Rosetta Predictions mouse pricing
XM_886363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316393 predicted 1456
2 SASI_Hs02_00316394 predicted 1612
3 SASI_Hs02_00316395 predicted 594
4 SASI_Hs02_00316396 predicted 2964
5 SASI_Hs02_00316397 predicted 3386
6 SASI_Hs02_00316398 predicted 3357
7 SASI_Hs02_00316399 predicted 2654
8 SASI_Hs02_00316400 predicted 1584
9 SASI_Hs02_00316401 predicted 3062
10 SASI_Hs02_00316402 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051118 predicted 1449
2 SASI_Hs02_00353487 predicted 1608
3 SASI_Hs01_00051119 predicted 584
4 SASI_Hs01_00051120 predicted 2966
5 SASI_Hs02_00353488 predicted 3378
6 SASI_Hs01_00051122 predicted 3353
7 SASI_Hs01_00051123 predicted 2639
8 SASI_Hs01_00051125 predicted 1574
9 SASI_Hs01_00051126 predicted 3054
10 SASI_Hs01_00051127 predicted 731
11 SASI_Hs01_00051121 predicted 1804
12 SASI_Hs01_00051124 predicted 2628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290818 predicted 3178
2 SASI_Rn02_00290819 predicted 2474
3 SASI_Rn02_00290820 predicted 1124
4 SASI_Rn02_00290821 predicted 1468
5 SASI_Rn02_00290822 predicted 1963
6 SASI_Rn02_00290823 predicted 2347
7 SASI_Rn02_00290824 predicted 2003
8 SASI_Rn02_00290825 predicted 1228
9 SASI_Rn02_00290826 predicted 2705
10 SASI_Rn02_00290827 predicted 2979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387400 predicted 3177
2 SASI_Rn02_00387401 predicted 2471
3 SASI_Rn02_00387402 predicted 1122
4 SASI_Rn02_00387403 predicted 1469
5 SASI_Rn02_00387404 predicted 1969
6 SASI_Rn02_00387405 predicted 2345
7 SASI_Rn02_00387406 predicted 1999
8 SASI_Rn02_00387407 predicted 1229
9 SASI_Rn02_00387408 predicted 2709
10 SASI_Rn02_00387409 predicted 2987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288722 predicted 1457
2 SASI_Mm02_00288723 predicted 1137
3 SASI_Mm02_00288724 predicted 2345
4 SASI_Mm02_00288725 predicted 912
5 SASI_Mm02_00288726 predicted 2354
6 SASI_Mm02_00288727 predicted 1613
7 SASI_Mm02_00288728 predicted 1576
8 SASI_Mm02_00288729 predicted 1476
9 SASI_Mm02_00288730 predicted 1873
10 SASI_Mm02_00288731 predicted 3356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202525 predicted 1454
2 SASI_Mm01_00202526 predicted 1144
3 SASI_Mm01_00202527 predicted 2350
4 SASI_Mm01_00202528 predicted 1793
5 SASI_Mm01_00202529 predicted 915
6 SASI_Mm01_00202530 predicted 2355
7 SASI_Mm01_00202531 predicted 1609
8 SASI_Mm01_00202532 predicted 1487
9 SASI_Mm01_00202533 predicted 1879
10 SASI_Mm01_00202534 predicted 3366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033422
VALIDATED
THOC2 MISSION shRNA Bacterial Glycerol Stock
THO complex 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-1581s21c1
Sequence:CCGGTCAGCATAGATATCGACTATACTCGAGTATAGTCGATATCTATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-4901s21c1
Sequence:CCGGGAATGACATCTCCCATATTTACTCGAGTAAATATGGGAGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-3362s21c1
Sequence:CCGGGCCTTGAGACGGGCGAATATACTCGAGTATATTCGCCCGTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033422.1-918s21c1
Sequence:CCGGGGATGAATACAAACGAGAAATCTCGAGATTTCTCGTTTGTATTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-1483s21c1
Sequence:CCGGAGCATTACTGACCAGGTATTACTCGAGTAATACCTGGTCAGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033422
VALIDATED
THOC2 MISSION shRNA shRNA Plasmid DNA
THO complex 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-1581s21c1
Sequence:CCGGTCAGCATAGATATCGACTATACTCGAGTATAGTCGATATCTATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-4901s21c1
Sequence:CCGGGAATGACATCTCCCATATTTACTCGAGTAAATATGGGAGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-3362s21c1
Sequence:CCGGGCCTTGAGACGGGCGAATATACTCGAGTATATTCGCCCGTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033422.1-918s21c1
Sequence:CCGGGGATGAATACAAACGAGAAATCTCGAGATTTCTCGTTTGTATTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-1483s21c1
Sequence:CCGGAGCATTACTGACCAGGTATTACTCGAGTAATACCTGGTCAGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033422
VALIDATED
THOC2 MISSION shRNA Lentiviral Transduction Particles
THO complex 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-1581s21c1
Sequence:CCGGTCAGCATAGATATCGACTATACTCGAGTATAGTCGATATCTATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-4901s21c1
Sequence:CCGGGAATGACATCTCCCATATTTACTCGAGTAAATATGGGAGATGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-3362s21c1
Sequence:CCGGGCCTTGAGACGGGCGAATATACTCGAGTATATTCGCCCGTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033422.1-918s21c1
Sequence:CCGGGGATGAATACAAACGAGAAATCTCGAGATTTCTCGTTTGTATTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033422.1-1483s21c1
Sequence:CCGGAGCATTACTGACCAGGTATTACTCGAGTAATACCTGGTCAGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081550
VALIDATED
THOC2 MISSION shRNA Bacterial Glycerol Stock
THO complex 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-2973s21c1
Sequence:CCGGTGTATATTTCCTCGATGTATTCTCGAGAATACATCGAGGAAATATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081550.1-5340s21c1
Sequence:CCGGGTACAACATTAAACGTGTTTACTCGAGTAAACACGTTTAATGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081550.1-3666s21c1
Sequence:GTACCGGTCAATAGGAAGTGCATCTAAACTCGAGTTTAGATGCACTTCCTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-3364s21c1
Sequence:CCGGGCCTTGAAACAGGCGAATATACTCGAGTATATTCGCCTGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-2491s21c1
Sequence:CCGGCAATGTATGCCCATCATATTTCTCGAGAAATATGATGGGCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081550
VALIDATED
THOC2 MISSION shRNA shRNA Plasmid DNA
THO complex 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-2973s21c1
Sequence:CCGGTGTATATTTCCTCGATGTATTCTCGAGAATACATCGAGGAAATATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081550.1-5340s21c1
Sequence:CCGGGTACAACATTAAACGTGTTTACTCGAGTAAACACGTTTAATGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081550.1-3666s21c1
Sequence:GTACCGGTCAATAGGAAGTGCATCTAAACTCGAGTTTAGATGCACTTCCTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-3364s21c1
Sequence:CCGGGCCTTGAAACAGGCGAATATACTCGAGTATATTCGCCTGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-2491s21c1
Sequence:CCGGCAATGTATGCCCATCATATTTCTCGAGAAATATGATGGGCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081550
VALIDATED
THOC2 MISSION shRNA Lentiviral Transduction Particles
THO complex 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-2973s21c1
Sequence:CCGGTGTATATTTCCTCGATGTATTCTCGAGAATACATCGAGGAAATATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081550.1-5340s21c1
Sequence:CCGGGTACAACATTAAACGTGTTTACTCGAGTAAACACGTTTAATGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081550.1-3666s21c1
Sequence:GTACCGGTCAATAGGAAGTGCATCTAAACTCGAGTTTAGATGCACTTCCTATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-3364s21c1
Sequence:CCGGGCCTTGAAACAGGCGAATATACTCGAGTATATTCGCCTGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001081550.1-2491s21c1
Sequence:CCGGCAATGTATGCCCATCATATTTCTCGAGAAATATGATGGGCATACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_047325
THOC2 MISSION shRNA Bacterial Glycerol Stock
THO complex 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_047325.7-5928s1c1
Sequence:CCGGGCTGTCTAATTCCAGAGCATTCTCGAGAATGCTCTGGAATTAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-1747s1c1
Sequence:CCGGGCCACAGCAATCCAACCATTTCTCGAGAAATGGTTGGATTGCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-3191s1c1
Sequence:CCGGGCATAGTGATAGAGCCACATACTCGAGTATGTGGCTCTATCACTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-274s1c1
Sequence:CCGGCCTCCATTCTTGCTGATGTATCTCGAGATACATCAGCAAGAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-3906s1c1
Sequence:CCGGGCCAGGGTACTTGGTAAAGATCTCGAGATCTTTACCAAGTACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_047325
THOC2 MISSION shRNA shRNA Plasmid DNA
THO complex 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_047325.7-5928s1c1
Sequence:CCGGGCTGTCTAATTCCAGAGCATTCTCGAGAATGCTCTGGAATTAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-1747s1c1
Sequence:CCGGGCCACAGCAATCCAACCATTTCTCGAGAAATGGTTGGATTGCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-3191s1c1
Sequence:CCGGGCATAGTGATAGAGCCACATACTCGAGTATGTGGCTCTATCACTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-274s1c1
Sequence:CCGGCCTCCATTCTTGCTGATGTATCTCGAGATACATCAGCAAGAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-3906s1c1
Sequence:CCGGGCCAGGGTACTTGGTAAAGATCTCGAGATCTTTACCAAGTACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_047325
THOC2 MISSION shRNA Lentiviral Transduction Particles
THO complex 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_047325.7-5928s1c1
Sequence:CCGGGCTGTCTAATTCCAGAGCATTCTCGAGAATGCTCTGGAATTAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-1747s1c1
Sequence:CCGGGCCACAGCAATCCAACCATTTCTCGAGAAATGGTTGGATTGCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-3191s1c1
Sequence:CCGGGCATAGTGATAGAGCCACATACTCGAGTATGTGGCTCTATCACTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-274s1c1
Sequence:CCGGCCTCCATTCTTGCTGATGTATCTCGAGATACATCAGCAAGAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047325.7-3906s1c1
Sequence:CCGGGCCAGGGTACTTGGTAAAGATCTCGAGATCTTTACCAAGTACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks