EMAIL THIS PAGE TO A FRIEND

THOC3

THO complex 3

Synonyms: THO3 hTREX45
UniProtKB ID: Q96J01
Gene ID:
Human(84321) Summary: This gene encodes a component of the nuclear THO transcription elongation complex, which is part of the larger transcription export (TREX) complex that couples messenger RNA processing and export. In humans, the transcription export complex is recruited to the 5'-end of messenger RNAs in a splicing- and cap-dependent manner. Studies of a related complex in mouse suggest that the metazoan transcription export complex is involved in cell differentiation and development. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, May 2013]
Mouse(73666) THO complex 3
Rat(290519) THO complex 3
Zebrafish(445302) THO complex 3
chicken(416232) THO complex 3
domestic cat(101083907) THO complex 3
dog(480781) THO complex 3
cow(529231) THO complex 3
sheep(101103479) THO complex 3
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41052 Anti-THOC3 antibody produced in rabbit IgG fraction of antiserum canine, zebrafish, bovine, guinea pig, mouse, rabbit, human, rat, horse
immunohistochemistry, western blot pricing
SAB2104503 Anti-THOC3 antibody produced in rabbit affinity isolated antibody canine, mouse, bovine, human, rabbit, zebrafish, guinea pig, rat, horse
western blot pricing
HPA044009 Anti-THOC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB1401888 Monoclonal Anti-THOC3 antibody produced in mouse clone 3D4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032361 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032361 Rosetta Predictions human pricing
XM_001723779 Rosetta Predictions human pricing
NM_001106059 Rosetta Predictions rat pricing
NM_028597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141598 predicted 1432
2 SASI_Hs01_00141599 predicted 628
3 SASI_Hs01_00141600 predicted 634
4 SASI_Hs01_00141601 predicted 656
5 SASI_Hs01_00141603 predicted 1485
6 SASI_Hs01_00141604 predicted 1035
7 SASI_Hs01_00141602 predicted 656
8 SASI_Hs01_00141605 predicted 870
9 SASI_Hs01_00141606 predicted 1088
10 SASI_Hs01_00141607 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00457550 predicted 468
2 SASI_Hs02_00457551 predicted 389
3 SASI_Hs02_00457552 predicted 262
4 SASI_Hs02_00457553 predicted 285
5 SASI_Hs02_00457554 predicted 402
6 SASI_Hs02_00457555 predicted 269
7 SASI_Hs02_00457556 predicted 525
8 SASI_Hs02_00457557 predicted 528
9 SASI_Hs02_00457558 predicted 503
10 SASI_Hs02_00457559 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215222 predicted 1120
2 SASI_Rn02_00215223 predicted 737
3 SASI_Rn02_00215224 predicted 799
4 SASI_Rn02_00215225 predicted 708
5 SASI_Rn02_00215226 predicted 642
6 SASI_Rn02_00215227 predicted 1050
7 SASI_Rn02_00215228 predicted 500
8 SASI_Rn02_00215229 predicted 832
9 SASI_Rn02_00215230 predicted 569
10 SASI_Rn02_00215231 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334077 predicted 1032
2 SASI_Mm02_00334078 predicted 266
3 SASI_Mm01_00086842 predicted 771
4 SASI_Mm02_00334079 predicted 1025
5 SASI_Mm01_00086843 predicted 305
6 SASI_Mm01_00086844 predicted 859
7 SASI_Mm01_00086845 predicted 748
8 SASI_Mm01_00086846 predicted 497
9 SASI_Mm02_00334080 predicted 465
10 SASI_Mm01_00086849 predicted 495
11 SASI_Mm01_00086847 predicted 339
12 SASI_Mm01_00086848 predicted 1062
13 SASI_Mm01_00086850 predicted 873
14 SASI_Mm01_00086851 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032361
VALIDATED
THOC3 MISSION shRNA Bacterial Glycerol Stock
THO complex 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032361.x-606s1c1
Sequence:CCGGGCAGTTCAAGTTCGAGGTCAACTCGAGTTGACCTCGAACTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032361.x-1046s1c1
Sequence:CCGGGTGATGACAAAGACGGCAAATCTCGAGATTTGCCGTCTTTGTCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-390s1c1
Sequence:CCGGGCATCCAAGTAATCCTGACCTCTCGAGAGGTCAGGATTACTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-577s1c1
Sequence:CCGGGCCAAGACACACCGTTCCAAACTCGAGTTTGGAACGGTGTGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-826s1c1
Sequence:CCGGGTGGATGAGTTAGTGTGTGTTCTCGAGAACACACACTAACTCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-655s21c1
Sequence:CCGGGCATCCAAGTAATCCTGACCTCTCGAGAGGTCAGGATTACTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-842s21c1
Sequence:CCGGGCCAAGACACACCGTTCCAAACTCGAGTTTGGAACGGTGTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-1311s21c1
Sequence:CCGGGTGATGACAAAGACGGCAAATCTCGAGATTTGCCGTCTTTGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-871s21c1
Sequence:CCGGGCAGTTCAAGTTCGAGGTCAACTCGAGTTGACCTCGAACTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032361
VALIDATED
THOC3 MISSION shRNA shRNA Plasmid DNA
THO complex 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032361.x-606s1c1
Sequence:CCGGGCAGTTCAAGTTCGAGGTCAACTCGAGTTGACCTCGAACTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032361.x-1046s1c1
Sequence:CCGGGTGATGACAAAGACGGCAAATCTCGAGATTTGCCGTCTTTGTCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-390s1c1
Sequence:CCGGGCATCCAAGTAATCCTGACCTCTCGAGAGGTCAGGATTACTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-577s1c1
Sequence:CCGGGCCAAGACACACCGTTCCAAACTCGAGTTTGGAACGGTGTGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-826s1c1
Sequence:CCGGGTGGATGAGTTAGTGTGTGTTCTCGAGAACACACACTAACTCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-655s21c1
Sequence:CCGGGCATCCAAGTAATCCTGACCTCTCGAGAGGTCAGGATTACTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-842s21c1
Sequence:CCGGGCCAAGACACACCGTTCCAAACTCGAGTTTGGAACGGTGTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-1311s21c1
Sequence:CCGGGTGATGACAAAGACGGCAAATCTCGAGATTTGCCGTCTTTGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-871s21c1
Sequence:CCGGGCAGTTCAAGTTCGAGGTCAACTCGAGTTGACCTCGAACTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032361
VALIDATED
THOC3 MISSION shRNA Lentiviral Transduction Particles
THO complex 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032361.x-606s1c1
Sequence:CCGGGCAGTTCAAGTTCGAGGTCAACTCGAGTTGACCTCGAACTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032361.x-1046s1c1
Sequence:CCGGGTGATGACAAAGACGGCAAATCTCGAGATTTGCCGTCTTTGTCATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-390s1c1
Sequence:CCGGGCATCCAAGTAATCCTGACCTCTCGAGAGGTCAGGATTACTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-577s1c1
Sequence:CCGGGCCAAGACACACCGTTCCAAACTCGAGTTTGGAACGGTGTGTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032361.x-826s1c1
Sequence:CCGGGTGGATGAGTTAGTGTGTGTTCTCGAGAACACACACTAACTCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-655s21c1
Sequence:CCGGGCATCCAAGTAATCCTGACCTCTCGAGAGGTCAGGATTACTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-842s21c1
Sequence:CCGGGCCAAGACACACCGTTCCAAACTCGAGTTTGGAACGGTGTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-1311s21c1
Sequence:CCGGGTGATGACAAAGACGGCAAATCTCGAGATTTGCCGTCTTTGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032361.2-871s21c1
Sequence:CCGGGCAGTTCAAGTTCGAGGTCAACTCGAGTTGACCTCGAACTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028597
VALIDATED
THOC3 MISSION shRNA Bacterial Glycerol Stock
THO complex 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-1111s1c1
Sequence:CCGGCGGACTATTTGGGCTACCTAACTCGAGTTAGGTAGCCCAAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-637s1c1
Sequence:CCGGCCTCAGCTACCCAGAATTGAACTCGAGTTCAATTCTGGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-499s1c1
Sequence:CCGGCGACGTTGTGACTTTCATTGACTCGAGTCAATGAAAGTCACAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-497s1c1
Sequence:CCGGGACGACGTTGTGACTTTCATTCTCGAGAATGAAAGTCACAACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-869s1c1
Sequence:CCGGGAGGACCATATCATTGATATACTCGAGTATATCAATGATATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-496s21c1
Sequence:CCGGGACGACGTTGTGACTTTCATTCTCGAGAATGAAAGTCACAACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-636s21c1
Sequence:CCGGCCTCAGCTACCCAGAATTGAACTCGAGTTCAATTCTGGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028597.2-1110s21c1
Sequence:CCGGCGGACTATTTGGGCTACCTAACTCGAGTTAGGTAGCCCAAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-868s21c1
Sequence:CCGGGAGGACCATATCATTGATATACTCGAGTATATCAATGATATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028597
VALIDATED
THOC3 MISSION shRNA shRNA Plasmid DNA
THO complex 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-1111s1c1
Sequence:CCGGCGGACTATTTGGGCTACCTAACTCGAGTTAGGTAGCCCAAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-637s1c1
Sequence:CCGGCCTCAGCTACCCAGAATTGAACTCGAGTTCAATTCTGGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-499s1c1
Sequence:CCGGCGACGTTGTGACTTTCATTGACTCGAGTCAATGAAAGTCACAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-497s1c1
Sequence:CCGGGACGACGTTGTGACTTTCATTCTCGAGAATGAAAGTCACAACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-869s1c1
Sequence:CCGGGAGGACCATATCATTGATATACTCGAGTATATCAATGATATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-496s21c1
Sequence:CCGGGACGACGTTGTGACTTTCATTCTCGAGAATGAAAGTCACAACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-636s21c1
Sequence:CCGGCCTCAGCTACCCAGAATTGAACTCGAGTTCAATTCTGGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028597.2-1110s21c1
Sequence:CCGGCGGACTATTTGGGCTACCTAACTCGAGTTAGGTAGCCCAAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-868s21c1
Sequence:CCGGGAGGACCATATCATTGATATACTCGAGTATATCAATGATATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028597
VALIDATED
THOC3 MISSION shRNA Lentiviral Transduction Particles
THO complex 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-1111s1c1
Sequence:CCGGCGGACTATTTGGGCTACCTAACTCGAGTTAGGTAGCCCAAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-637s1c1
Sequence:CCGGCCTCAGCTACCCAGAATTGAACTCGAGTTCAATTCTGGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-499s1c1
Sequence:CCGGCGACGTTGTGACTTTCATTGACTCGAGTCAATGAAAGTCACAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-497s1c1
Sequence:CCGGGACGACGTTGTGACTTTCATTCTCGAGAATGAAAGTCACAACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028597.1-869s1c1
Sequence:CCGGGAGGACCATATCATTGATATACTCGAGTATATCAATGATATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-496s21c1
Sequence:CCGGGACGACGTTGTGACTTTCATTCTCGAGAATGAAAGTCACAACGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-636s21c1
Sequence:CCGGCCTCAGCTACCCAGAATTGAACTCGAGTTCAATTCTGGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028597.2-1110s21c1
Sequence:CCGGCGGACTATTTGGGCTACCTAACTCGAGTTAGGTAGCCCAAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028597.2-868s21c1
Sequence:CCGGGAGGACCATATCATTGATATACTCGAGTATATCAATGATATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks