EMAIL THIS PAGE TO A FRIEND

THOC5

THO complex 5

Synonyms: C22orf19 Fmip PK1.3 fSAP79
UniProtKB ID: Q13769, O60839, Q9UPZ5
Gene ID:
Mouse(107829) THO complex 5
Rat(360972) THO complex 5
fruit fly(37810) CG2980 gene product from transcript CG2980-RA
chicken(417019) THO complex 5
Horse(100059017) THO complex 5
domestic cat(101087528) THO complex 5
dog(477534) THO complex 5
Zebrafish(325064) THO complex 5
cow(533001) THO complex 5
sheep(101107735) THO complex 5
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003678 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002877 Rosetta Predictions human pricing
NM_001002878 Rosetta Predictions human pricing
NM_001002879 Rosetta Predictions human pricing
NM_003678 Rosetta Predictions human pricing
NM_001012153 Rosetta Predictions rat pricing
XM_573645 Rosetta Predictions rat pricing
NM_172438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100631 predicted 1492
2 SASI_Hs02_00304235 predicted 574
3 SASI_Hs01_00100632 predicted 661
4 SASI_Hs02_00304236 predicted 2209
5 SASI_Hs01_00100634 predicted 1308
6 SASI_Hs02_00304237 predicted 2231
7 SASI_Hs01_00100636 predicted 503
8 SASI_Hs01_00100637 predicted 632
9 SASI_Hs01_00100638 predicted 1057
10 SASI_Hs01_00100639 predicted 1156
11 SASI_Hs01_00100633 predicted 1769
12 SASI_Hs01_00100635 predicted 1451
13 SASI_Hs01_00100640 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219642 predicted 1623
2 SASI_Hs02_00304238 predicted 703
3 SASI_Hs01_00219643 predicted 798
4 SASI_Hs02_00304239 predicted 2333
5 SASI_Hs01_00219645 predicted 1440
6 SASI_Hs02_00304240 predicted 2364
7 SASI_Hs01_00219647 predicted 638
8 SASI_Hs01_00219648 predicted 757
9 SASI_Hs01_00219649 predicted 1184
10 SASI_Hs01_00219650 predicted 1292
11 SASI_Hs01_00219644 predicted 1909
12 SASI_Hs01_00219646 predicted 1582
13 SASI_Hs01_00219651 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073973 predicted 1505
2 SASI_Hs02_00304241 predicted 584
3 SASI_Hs01_00073974 predicted 684
4 SASI_Hs02_00304242 predicted 2220
5 SASI_Hs01_00073976 predicted 1318
6 SASI_Hs02_00304243 predicted 2248
7 SASI_Hs01_00073978 predicted 522
8 SASI_Hs01_00073979 predicted 646
9 SASI_Hs01_00073980 predicted 1069
10 SASI_Hs01_00073981 predicted 1174
11 SASI_Hs01_00073975 predicted 1785
12 SASI_Hs01_00073977 predicted 1464
13 SASI_Hs01_00073982 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020581 predicted 1375
2 SASI_Hs02_00336080 predicted 452
3 SASI_Hs01_00020582 predicted 551
4 SASI_Hs02_00336081 predicted 2088
5 SASI_Hs01_00020584 predicted 1195
6 SASI_Hs02_00336082 predicted 2116
7 SASI_Hs01_00020586 predicted 391
8 SASI_Hs01_00020587 predicted 511
9 SASI_Hs01_00020588 predicted 941
10 SASI_Hs01_00020589 predicted 1045
11 SASI_Hs01_00020583 predicted 1655
12 SASI_Hs01_00020585 predicted 1331
13 SASI_Hs01_00020590 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096394 predicted 1259
2 SASI_Rn01_00096395 predicted 324
3 SASI_Rn02_00200339 predicted 1584
4 SASI_Rn01_00096397 predicted 297
5 SASI_Rn01_00096398 predicted 1264
6 SASI_Rn01_00096399 predicted 478
7 SASI_Rn01_00096400 predicted 1304
8 SASI_Rn02_00200340 predicted 334
9 SASI_Rn01_00096401 predicted 1250
10 SASI_Rn01_00096402 predicted 1092
11 SASI_Rn01_00096393 predicted 1568
12 SASI_Rn01_00096396 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124199 predicted 1609
2 SASI_Rn01_00124200 predicted 1300
3 SASI_Rn01_00124201 predicted 1593
4 SASI_Rn01_00124202 predicted 358
5 SASI_Rn01_00124203 predicted 1350
6 SASI_Rn01_00124204 predicted 1311
7 SASI_Rn01_00124205 predicted 521
8 SASI_Rn01_00124206 predicted 1292
9 SASI_Rn01_00124207 predicted 1342
10 SASI_Rn01_00124208 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158998 predicted 202
2 SASI_Mm01_00158999 predicted 1158
3 SASI_Mm01_00159000 predicted 1299
4 SASI_Mm01_00159001 predicted 1291
5 SASI_Mm01_00159002 predicted 356
6 SASI_Mm01_00159003 predicted 1229
7 SASI_Mm01_00159004 predicted 1350
8 SASI_Mm01_00159005 predicted 788
9 SASI_Mm01_00159006 predicted 292
10 SASI_Mm01_00159007 predicted 1865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172438
VALIDATED
THOC5 MISSION shRNA Bacterial Glycerol Stock
THO complex 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172438.3-1297s21c1
Sequence:CCGGCAAATCCAGCCAATCAGTATCCTCGAGGATACTGATTGGCTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172438.3-1705s21c1
Sequence:CCGGTCTACTACCTGGCGCTAATTGCTCGAGCAATTAGCGCCAGGTAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1610s1c1
Sequence:CCGGCCTGGTAAAGTGGGTGATAATCTCGAGATTATCACCCACTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172438.1-298s1c1
Sequence:CCGGCCATTGAAATTGAAGAACGAACTCGAGTTCGTTCTTCAATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1838s1c1
Sequence:CCGGCGATGACAATATTCGGGCTATCTCGAGATAGCCCGAATATTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1597s1c1
Sequence:CCGGAGGTTGTTTCTCGCCTGGTAACTCGAGTTACCAGGCGAGAAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172438.1-608s1c1
Sequence:CCGGCCAACAAACATTGGCACGTTTCTCGAGAAACGTGCCAATGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172438
VALIDATED
THOC5 MISSION shRNA shRNA Plasmid DNA
THO complex 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172438.3-1297s21c1
Sequence:CCGGCAAATCCAGCCAATCAGTATCCTCGAGGATACTGATTGGCTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172438.3-1705s21c1
Sequence:CCGGTCTACTACCTGGCGCTAATTGCTCGAGCAATTAGCGCCAGGTAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1610s1c1
Sequence:CCGGCCTGGTAAAGTGGGTGATAATCTCGAGATTATCACCCACTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172438.1-298s1c1
Sequence:CCGGCCATTGAAATTGAAGAACGAACTCGAGTTCGTTCTTCAATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1838s1c1
Sequence:CCGGCGATGACAATATTCGGGCTATCTCGAGATAGCCCGAATATTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1597s1c1
Sequence:CCGGAGGTTGTTTCTCGCCTGGTAACTCGAGTTACCAGGCGAGAAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172438.1-608s1c1
Sequence:CCGGCCAACAAACATTGGCACGTTTCTCGAGAAACGTGCCAATGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172438
VALIDATED
THOC5 MISSION shRNA Lentiviral Transduction Particles
THO complex 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172438.3-1297s21c1
Sequence:CCGGCAAATCCAGCCAATCAGTATCCTCGAGGATACTGATTGGCTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172438.3-1705s21c1
Sequence:CCGGTCTACTACCTGGCGCTAATTGCTCGAGCAATTAGCGCCAGGTAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1610s1c1
Sequence:CCGGCCTGGTAAAGTGGGTGATAATCTCGAGATTATCACCCACTTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172438.1-298s1c1
Sequence:CCGGCCATTGAAATTGAAGAACGAACTCGAGTTCGTTCTTCAATTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1838s1c1
Sequence:CCGGCGATGACAATATTCGGGCTATCTCGAGATAGCCCGAATATTGTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172438.1-1597s1c1
Sequence:CCGGAGGTTGTTTCTCGCCTGGTAACTCGAGTTACCAGGCGAGAAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172438.1-608s1c1
Sequence:CCGGCCAACAAACATTGGCACGTTTCTCGAGAAACGTGCCAATGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003678
VALIDATED
THOC5 MISSION shRNA Bacterial Glycerol Stock
THO complex 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-701s21c1
Sequence:CCGGTACCGAGAGTGCCTATCTAACCTCGAGGTTAGATAGGCACTCTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-1334s21c1
Sequence:CCGGCCAGCCAATCAGTATCAGTTTCTCGAGAAACTGATACTGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-1367s21c1
Sequence:CCGGATCCTGACTTTGAGCGACTATCTCGAGATAGTCGCTCAAAGTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-2210s21c1
Sequence:CCGGCCCACATGTGACTCTTGATATCTCGAGATATCAAGAGTCACATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-323s21c1
Sequence:CCGGGATGTGGCAATAGAAATAGAACTCGAGTTCTATTTCTATTGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-1301s1c1
Sequence:CCGGCCAGCCAATCAGTATCAGTTTCTCGAGAAACTGATACTGATTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-1334s1c1
Sequence:CCGGATCCTGACTTTGAGCGACTATCTCGAGATAGTCGCTCAAAGTCAGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-290s1c1
Sequence:CCGGGATGTGGCAATAGAAATAGAACTCGAGTTCTATTTCTATTGCCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003678.x-4304s1c1
Sequence:CCGGGTCAAAGTAAAGGATGGCATACTCGAGTATGCCATCCTTTACTTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-473s1c1
Sequence:CCGGCTACAGAAGGAGATCACCAAACTCGAGTTTGGTGATCTCCTTCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003678
VALIDATED
THOC5 MISSION shRNA shRNA Plasmid DNA
THO complex 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-701s21c1
Sequence:CCGGTACCGAGAGTGCCTATCTAACCTCGAGGTTAGATAGGCACTCTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-1334s21c1
Sequence:CCGGCCAGCCAATCAGTATCAGTTTCTCGAGAAACTGATACTGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-1367s21c1
Sequence:CCGGATCCTGACTTTGAGCGACTATCTCGAGATAGTCGCTCAAAGTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-2210s21c1
Sequence:CCGGCCCACATGTGACTCTTGATATCTCGAGATATCAAGAGTCACATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-323s21c1
Sequence:CCGGGATGTGGCAATAGAAATAGAACTCGAGTTCTATTTCTATTGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-1301s1c1
Sequence:CCGGCCAGCCAATCAGTATCAGTTTCTCGAGAAACTGATACTGATTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-1334s1c1
Sequence:CCGGATCCTGACTTTGAGCGACTATCTCGAGATAGTCGCTCAAAGTCAGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-290s1c1
Sequence:CCGGGATGTGGCAATAGAAATAGAACTCGAGTTCTATTTCTATTGCCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003678.x-4304s1c1
Sequence:CCGGGTCAAAGTAAAGGATGGCATACTCGAGTATGCCATCCTTTACTTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-473s1c1
Sequence:CCGGCTACAGAAGGAGATCACCAAACTCGAGTTTGGTGATCTCCTTCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003678
VALIDATED
THOC5 MISSION shRNA Lentiviral Transduction Particles
THO complex 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-701s21c1
Sequence:CCGGTACCGAGAGTGCCTATCTAACCTCGAGGTTAGATAGGCACTCTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-1334s21c1
Sequence:CCGGCCAGCCAATCAGTATCAGTTTCTCGAGAAACTGATACTGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-1367s21c1
Sequence:CCGGATCCTGACTTTGAGCGACTATCTCGAGATAGTCGCTCAAAGTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-2210s21c1
Sequence:CCGGCCCACATGTGACTCTTGATATCTCGAGATATCAAGAGTCACATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003678.4-323s21c1
Sequence:CCGGGATGTGGCAATAGAAATAGAACTCGAGTTCTATTTCTATTGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-1301s1c1
Sequence:CCGGCCAGCCAATCAGTATCAGTTTCTCGAGAAACTGATACTGATTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-1334s1c1
Sequence:CCGGATCCTGACTTTGAGCGACTATCTCGAGATAGTCGCTCAAAGTCAGGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-290s1c1
Sequence:CCGGGATGTGGCAATAGAAATAGAACTCGAGTTCTATTTCTATTGCCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003678.x-4304s1c1
Sequence:CCGGGTCAAAGTAAAGGATGGCATACTCGAGTATGCCATCCTTTACTTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003678.x-473s1c1
Sequence:CCGGCTACAGAAGGAGATCACCAAACTCGAGTTTGGTGATCTCCTTCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks