EMAIL THIS PAGE TO A FRIEND

THOC6

THO complex 6 homolog (Drosophila)

Synonyms: WDR58 fSAP35
UniProtKB ID: Q86W42, B2RA85, Q8NBR1, Q9BTV9
Gene ID:
Mouse(386612) THO complex 6 homolog (Drosophila)
Rat(79227) THO complex 6 homolog (Drosophila)
cow(100125940) THO complex 6 homolog (Drosophila)
sheep(101117811) THO complex 6 homolog (Drosophila)
naked mole-rat(101724280) THO complex 6 homolog (Drosophila)
domestic guinea pig(100736057) THO complex 6 homolog (Drosophila)
fruit fly(39394) CG5632 gene product from transcript CG5632-RA
domestic cat(101099608) THO complex 6 homolog (Drosophila)
dog(479871) THO complex 6 homolog (Drosophila)
Zebrafish(100004014) THO complex 6 homolog (Drosophila)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024339 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024339 Rosetta Predictions human pricing
NM_024384 Rosetta Predictions rat pricing
NM_001008425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158834 predicted 600
2 SASI_Hs01_00158835 predicted 842
3 SASI_Hs02_00356693 predicted 525
4 SASI_Hs01_00158836 predicted 482
5 SASI_Hs01_00158837 predicted 796
6 SASI_Hs02_00356694 predicted 473
7 SASI_Hs01_00158838 predicted 289
8 SASI_Hs01_00158839 predicted 683
9 SASI_Hs01_00158840 predicted 843
10 SASI_Hs01_00158841 predicted 899
11 SASI_Hs01_00158833 predicted 525
12 SASI_Hs01_00158842 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121735 predicted 1074
2 SASI_Rn01_00121736 predicted 815
3 SASI_Rn01_00121737 predicted 515
4 SASI_Rn02_00263981 predicted 1010
5 SASI_Rn02_00263982 predicted 286
6 SASI_Rn02_00263983 predicted 537
7 SASI_Rn01_00121739 predicted 1027
8 SASI_Rn01_00121741 predicted 844
9 SASI_Rn01_00121742 predicted 686
10 SASI_Rn01_00121743 predicted 818
11 SASI_Rn01_00121738 predicted 614
12 SASI_Rn01_00121740 predicted 927
13 SASI_Rn01_00121744 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092332 predicted 436
2 SASI_Mm01_00092333 predicted 577
3 SASI_Mm01_00092334 predicted 792
4 SASI_Mm01_00092335 predicted 1159
5 SASI_Mm01_00092336 predicted 1185
6 SASI_Mm01_00092337 predicted 963
7 SASI_Mm02_00286797 predicted 1160
8 SASI_Mm01_00092338 predicted 1183
9 SASI_Mm01_00092339 predicted 831
10 SASI_Mm01_00092340 predicted 970
11 SASI_Mm01_00092341 predicted 1014
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008425
VALIDATED
THOC6 MISSION shRNA Bacterial Glycerol Stock
THO complex 6 homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008425.1-1268s1c1
Sequence:CCGGGCTAGAGTGATGCTTGTGTTTCTCGAGAAACACAAGCATCACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-282s1c1
Sequence:CCGGCGACTGCACATGACCATCTTTCTCGAGAAAGATGGTCATGTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-666s1c1
Sequence:CCGGCTGCACAGTATGGATCTGGAACTCGAGTTCCAGATCCATACTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-384s1c1
Sequence:CCGGGCCTTAAGTTCAGAGGCCAAACTCGAGTTTGGCCTCTGAACTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-1186s1c1
Sequence:CCGGGCTGTCGAGTAGATGTCTTTACTCGAGTAAAGACATCTACTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-1241s21c1
Sequence:CCGGTTGACATCATGACCCTGTATTCTCGAGAATACAGGGTCATGATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-1267s21c1
Sequence:CCGGAGCTAGAGTGATGCTTGTGTTCTCGAGAACACAAGCATCACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-795s21c1
Sequence:CCGGCGGCTTTGGGATCTCCGTATACTCGAGTATACGGAGATCCCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-585s21c1
Sequence:CCGGAGTCTGGAAGTACCCGAAATCCTCGAGGATTTCGGGTACTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008425.1-331s21c1
Sequence:CCGGTTCTGGCAGCTGGCAACAATTCTCGAGAATTGTTGCCAGCTGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008425
VALIDATED
THOC6 MISSION shRNA shRNA Plasmid DNA
THO complex 6 homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008425.1-1268s1c1
Sequence:CCGGGCTAGAGTGATGCTTGTGTTTCTCGAGAAACACAAGCATCACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-282s1c1
Sequence:CCGGCGACTGCACATGACCATCTTTCTCGAGAAAGATGGTCATGTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-666s1c1
Sequence:CCGGCTGCACAGTATGGATCTGGAACTCGAGTTCCAGATCCATACTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-384s1c1
Sequence:CCGGGCCTTAAGTTCAGAGGCCAAACTCGAGTTTGGCCTCTGAACTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-1186s1c1
Sequence:CCGGGCTGTCGAGTAGATGTCTTTACTCGAGTAAAGACATCTACTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-1241s21c1
Sequence:CCGGTTGACATCATGACCCTGTATTCTCGAGAATACAGGGTCATGATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-1267s21c1
Sequence:CCGGAGCTAGAGTGATGCTTGTGTTCTCGAGAACACAAGCATCACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-795s21c1
Sequence:CCGGCGGCTTTGGGATCTCCGTATACTCGAGTATACGGAGATCCCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-585s21c1
Sequence:CCGGAGTCTGGAAGTACCCGAAATCCTCGAGGATTTCGGGTACTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008425.1-331s21c1
Sequence:CCGGTTCTGGCAGCTGGCAACAATTCTCGAGAATTGTTGCCAGCTGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008425
VALIDATED
THOC6 MISSION shRNA Lentiviral Transduction Particles
THO complex 6 homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008425.1-1268s1c1
Sequence:CCGGGCTAGAGTGATGCTTGTGTTTCTCGAGAAACACAAGCATCACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-282s1c1
Sequence:CCGGCGACTGCACATGACCATCTTTCTCGAGAAAGATGGTCATGTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-666s1c1
Sequence:CCGGCTGCACAGTATGGATCTGGAACTCGAGTTCCAGATCCATACTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-384s1c1
Sequence:CCGGGCCTTAAGTTCAGAGGCCAAACTCGAGTTTGGCCTCTGAACTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008425.1-1186s1c1
Sequence:CCGGGCTGTCGAGTAGATGTCTTTACTCGAGTAAAGACATCTACTCGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-1241s21c1
Sequence:CCGGTTGACATCATGACCCTGTATTCTCGAGAATACAGGGTCATGATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-1267s21c1
Sequence:CCGGAGCTAGAGTGATGCTTGTGTTCTCGAGAACACAAGCATCACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-795s21c1
Sequence:CCGGCGGCTTTGGGATCTCCGTATACTCGAGTATACGGAGATCCCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001008425.1-585s21c1
Sequence:CCGGAGTCTGGAAGTACCCGAAATCCTCGAGGATTTCGGGTACTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008425.1-331s21c1
Sequence:CCGGTTCTGGCAGCTGGCAACAATTCTCGAGAATTGTTGCCAGCTGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024339
THOC6 MISSION shRNA Bacterial Glycerol Stock
THO complex 6 homolog (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-358s1c1
Sequence:CCGGTGGCAACAATTACGGGCAGATCTCGAGATCTGCCCGTAATTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-298s1c1
Sequence:CCGGGCGGCTCCATATGACCATCTTCTCGAGAAGATGGTCATATGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-673s1c1
Sequence:CCGGAGACTGTCAGTTGCACACTATCTCGAGATAGTGTGCAACTGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-798s1c1
Sequence:CCGGAGGATGGAGCTGTTCGACTTTCTCGAGAAAGTCGAACAGCTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-610s1c1
Sequence:CCGGAGTGCCTGAGATCAACGCTTTCTCGAGAAAGCGTTGATCTCAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024339.3-965s21c1
Sequence:CCGGTGGATGTTTGGCAACTGATTCCTCGAGGAATCAGTTGCCAAACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024339.3-393s21c1
Sequence:CCGGTCACCATGTGGGAAGTTTCTGCTCGAGCAGAAACTTCCCACATGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024339
THOC6 MISSION shRNA shRNA Plasmid DNA
THO complex 6 homolog (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-358s1c1
Sequence:CCGGTGGCAACAATTACGGGCAGATCTCGAGATCTGCCCGTAATTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-298s1c1
Sequence:CCGGGCGGCTCCATATGACCATCTTCTCGAGAAGATGGTCATATGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-673s1c1
Sequence:CCGGAGACTGTCAGTTGCACACTATCTCGAGATAGTGTGCAACTGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-798s1c1
Sequence:CCGGAGGATGGAGCTGTTCGACTTTCTCGAGAAAGTCGAACAGCTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-610s1c1
Sequence:CCGGAGTGCCTGAGATCAACGCTTTCTCGAGAAAGCGTTGATCTCAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024339.3-965s21c1
Sequence:CCGGTGGATGTTTGGCAACTGATTCCTCGAGGAATCAGTTGCCAAACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024339.3-393s21c1
Sequence:CCGGTCACCATGTGGGAAGTTTCTGCTCGAGCAGAAACTTCCCACATGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024339
THOC6 MISSION shRNA Lentiviral Transduction Particles
THO complex 6 homolog (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-358s1c1
Sequence:CCGGTGGCAACAATTACGGGCAGATCTCGAGATCTGCCCGTAATTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-298s1c1
Sequence:CCGGGCGGCTCCATATGACCATCTTCTCGAGAAGATGGTCATATGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-673s1c1
Sequence:CCGGAGACTGTCAGTTGCACACTATCTCGAGATAGTGTGCAACTGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-798s1c1
Sequence:CCGGAGGATGGAGCTGTTCGACTTTCTCGAGAAAGTCGAACAGCTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024339.2-610s1c1
Sequence:CCGGAGTGCCTGAGATCAACGCTTTCTCGAGAAAGCGTTGATCTCAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024339.3-965s21c1
Sequence:CCGGTGGATGTTTGGCAACTGATTCCTCGAGGAATCAGTTGCCAAACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024339.3-393s21c1
Sequence:CCGGTCACCATGTGGGAAGTTTCTGCTCGAGCAGAAACTTCCCACATGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks