EMAIL THIS PAGE TO A FRIEND

THOC7

THO complex 7 homolog (Drosophila)

Synonyms: NIF3L1BP1 fSAP24
UniProtKB ID: Q6I9Y2, Q6P1L3, Q8WUF2, Q9H5H0
Gene ID:
Mouse(66231) THO complex 7 homolog (Drosophila)
Rat(305714) THO complex 7 homolog (Drosophila)
fruit fly(38033) CG17143 gene product from transcript CG17143-RB
domestic cat(101086380) THO complex 7 homolog (Drosophila)
dog(476567) THO complex 7 homolog (Drosophila)
chicken(416077) THO complex 7 homolog (Drosophila)
Zebrafish(445035) THO complex 7
domestic guinea pig(100733190) THO complex 7 homolog (Drosophila)
naked mole-rat(101704221) THO complex 7 homolog (Drosophila)
cow(510250) THO complex 7 homolog (Drosophila)
sheep(101106888) THO complex 7 homolog (Drosophila)
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025075 Rosetta Predictions human pricing
XM_001069423 Rosetta Predictions rat pricing
XM_223828 Rosetta Predictions rat pricing
NM_001013578 Rosetta Predictions mouse pricing
NM_025435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199906 predicted 735
2 SASI_Hs02_00357750 predicted 703
3 SASI_Hs01_00199904 predicted 609
4 SASI_Hs01_00199905 predicted 593
5 SASI_Hs02_00357751 predicted 722
6 SASI_Hs01_00199908 predicted 397
7 SASI_Hs01_00199909 predicted 610
8 SASI_Hs01_00199911 predicted 688
9 SASI_Hs02_00357752 predicted 619
10 SASI_Hs01_00199912 predicted 379
11 SASI_Hs01_00199907 predicted 433
12 SASI_Hs01_00199910 predicted 532
13 SASI_Hs01_00199913 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327955 predicted 1206
2 SASI_Rn02_00327956 predicted 1214
3 SASI_Rn02_00327957 predicted 988
4 SASI_Rn02_00327958 predicted 1364
5 SASI_Rn02_00327959 predicted 823
6 SASI_Rn02_00327960 predicted 985
7 SASI_Rn02_00327961 predicted 1161
8 SASI_Rn02_00327962 predicted 1068
9 SASI_Rn02_00327963 predicted 1238
10 SASI_Rn02_00327964 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381700 predicted 662
2 SASI_Rn02_00381701 predicted 667
3 SASI_Rn02_00381702 predicted 443
4 SASI_Rn02_00381703 predicted 819
5 SASI_Rn02_00381704 predicted 284
6 SASI_Rn02_00381705 predicted 440
7 SASI_Rn02_00381706 predicted 623
8 SASI_Rn02_00381707 predicted 525
9 SASI_Rn02_00381708 predicted 691
10 SASI_Rn02_00381709 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037494 predicted 284
2 SASI_Mm01_00037495 predicted 412
3 SASI_Mm01_00037496 predicted 444
4 SASI_Mm01_00037497 predicted 429
5 SASI_Mm01_00037499 predicted 228
6 SASI_Mm01_00037500 predicted 374
7 SASI_Mm02_00287242 predicted 468
8 SASI_Mm01_00037501 predicted 408
9 SASI_Mm01_00037502 predicted 279
10 SASI_Mm01_00037503 predicted 423
11 SASI_Mm01_00037498 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039098 predicted 291
2 SASI_Mm01_00039099 predicted 504
3 SASI_Mm01_00039100 predicted 495
4 SASI_Mm02_00328258 predicted 515
5 SASI_Mm01_00039101 predicted 646
6 SASI_Mm01_00039103 predicted 638
7 SASI_Mm01_00039104 predicted 216
8 SASI_Mm01_00039105 predicted 377
9 SASI_Mm01_00039106 predicted 537
10 SASI_Mm01_00039107 predicted 550
11 SASI_Mm01_00039102 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025075
VALIDATED
THOC7 MISSION shRNA Bacterial Glycerol Stock
THO complex 7 homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-653s21c1
Sequence:CCGGCCATGAACTTCAGCAAACATTCTCGAGAATGTTTGCTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-769s21c1
Sequence:CCGGCCAGGAATATTGAAATAGCTACTCGAGTAGCTATTTCAATATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025075.2-218s21c1
Sequence:CCGGGCTAGTGAAGAGTTTCATTAACTCGAGTTAATGAAACTCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-618s21c1
Sequence:CCGGAGACGGAAACAGTTTCATGTTCTCGAGAACATGAAACTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-681s1c1
Sequence:CCGGCCAGGAATATTGAAATAGCTACTCGAGTAGCTATTTCAATATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-130s1c1
Sequence:CCGGGCTAGTGAAGAGTTTCATTAACTCGAGTTAATGAAACTCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-533s1c1
Sequence:CCGGCGGAAACAGTTTCATGTTCTTCTCGAGAAGAACATGAAACTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-530s1c1
Sequence:CCGGAGACGGAAACAGTTTCATGTTCTCGAGAACATGAAACTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-565s1c1
Sequence:CCGGCCATGAACTTCAGCAAACATTCTCGAGAATGTTTGCTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025075
VALIDATED
THOC7 MISSION shRNA shRNA Plasmid DNA
THO complex 7 homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-653s21c1
Sequence:CCGGCCATGAACTTCAGCAAACATTCTCGAGAATGTTTGCTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-769s21c1
Sequence:CCGGCCAGGAATATTGAAATAGCTACTCGAGTAGCTATTTCAATATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025075.2-218s21c1
Sequence:CCGGGCTAGTGAAGAGTTTCATTAACTCGAGTTAATGAAACTCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-618s21c1
Sequence:CCGGAGACGGAAACAGTTTCATGTTCTCGAGAACATGAAACTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-681s1c1
Sequence:CCGGCCAGGAATATTGAAATAGCTACTCGAGTAGCTATTTCAATATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-130s1c1
Sequence:CCGGGCTAGTGAAGAGTTTCATTAACTCGAGTTAATGAAACTCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-533s1c1
Sequence:CCGGCGGAAACAGTTTCATGTTCTTCTCGAGAAGAACATGAAACTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-530s1c1
Sequence:CCGGAGACGGAAACAGTTTCATGTTCTCGAGAACATGAAACTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-565s1c1
Sequence:CCGGCCATGAACTTCAGCAAACATTCTCGAGAATGTTTGCTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025075
VALIDATED
THOC7 MISSION shRNA Lentiviral Transduction Particles
THO complex 7 homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-653s21c1
Sequence:CCGGCCATGAACTTCAGCAAACATTCTCGAGAATGTTTGCTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-769s21c1
Sequence:CCGGCCAGGAATATTGAAATAGCTACTCGAGTAGCTATTTCAATATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025075.2-218s21c1
Sequence:CCGGGCTAGTGAAGAGTTTCATTAACTCGAGTTAATGAAACTCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025075.2-618s21c1
Sequence:CCGGAGACGGAAACAGTTTCATGTTCTCGAGAACATGAAACTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-681s1c1
Sequence:CCGGCCAGGAATATTGAAATAGCTACTCGAGTAGCTATTTCAATATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-130s1c1
Sequence:CCGGGCTAGTGAAGAGTTTCATTAACTCGAGTTAATGAAACTCTTCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-533s1c1
Sequence:CCGGCGGAAACAGTTTCATGTTCTTCTCGAGAAGAACATGAAACTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-530s1c1
Sequence:CCGGAGACGGAAACAGTTTCATGTTCTCGAGAACATGAAACTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025075.1-565s1c1
Sequence:CCGGCCATGAACTTCAGCAAACATTCTCGAGAATGTTTGCTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025435
VALIDATED
THOC7 MISSION shRNA Bacterial Glycerol Stock
THO complex 7 homolog (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-702s1c1
Sequence:CCGGTCCTGGGTTCAGTGTGTTGTACTCGAGTACAACACACTGAACCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-524s1c1
Sequence:CCGGAGACGGAAACAATTTCACGTTCTCGAGAACGTGAAATTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-382s1c1
Sequence:CCGGTCGACAAGAATATGACGCTTTCTCGAGAAAGCGTCATATTCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-527s1c1
Sequence:CCGGCGGAAACAATTTCACGTTCTTCTCGAGAAGAACGTGAAATTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-501s1c1
Sequence:CCGGGTGTTGAAGATAAGCTGGAATCTCGAGATTCCAGCTTATCTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025435
VALIDATED
THOC7 MISSION shRNA shRNA Plasmid DNA
THO complex 7 homolog (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-702s1c1
Sequence:CCGGTCCTGGGTTCAGTGTGTTGTACTCGAGTACAACACACTGAACCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-524s1c1
Sequence:CCGGAGACGGAAACAATTTCACGTTCTCGAGAACGTGAAATTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-382s1c1
Sequence:CCGGTCGACAAGAATATGACGCTTTCTCGAGAAAGCGTCATATTCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-527s1c1
Sequence:CCGGCGGAAACAATTTCACGTTCTTCTCGAGAAGAACGTGAAATTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-501s1c1
Sequence:CCGGGTGTTGAAGATAAGCTGGAATCTCGAGATTCCAGCTTATCTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025435
VALIDATED
THOC7 MISSION shRNA Lentiviral Transduction Particles
THO complex 7 homolog (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-702s1c1
Sequence:CCGGTCCTGGGTTCAGTGTGTTGTACTCGAGTACAACACACTGAACCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-524s1c1
Sequence:CCGGAGACGGAAACAATTTCACGTTCTCGAGAACGTGAAATTGTTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-382s1c1
Sequence:CCGGTCGACAAGAATATGACGCTTTCTCGAGAAAGCGTCATATTCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-527s1c1
Sequence:CCGGCGGAAACAATTTCACGTTCTTCTCGAGAAGAACGTGAAATTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025435.1-501s1c1
Sequence:CCGGGTGTTGAAGATAAGCTGGAATCTCGAGATTCCAGCTTATCTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks