EMAIL THIS PAGE TO A FRIEND

THOP1

thimet oligopeptidase 1

Synonyms: EP24.15 MEPD_HUMAN MP78 TOP
UniProtKB ID: P52888, Q9UCB3
Gene ID:
Mouse(50492) thimet oligopeptidase 1
Rat(64517) thimet oligopeptidase 1
Zebrafish(449659) thimet oligopeptidase 1
domestic cat(101083746) thimet oligopeptidase 1
dog(476748) thimet oligopeptidase 1
cow(510889) thimet oligopeptidase 1
sheep(101119557) thimet oligopeptidase 1
naked mole-rat(101714143) thimet oligopeptidase 1
domestic guinea pig(100731879) thimet oligopeptidase 1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003249 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003249 Rosetta Predictions human pricing
NM_172075 Rosetta Predictions rat pricing
NM_022653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091305 predicted 666
2 SASI_Hs01_00091307 predicted 354
3 SASI_Hs01_00091308 predicted 2048
4 SASI_Hs01_00091309 predicted 376
5 SASI_Hs01_00091310 predicted 1552
6 SASI_Hs01_00091311 predicted 1390
7 SASI_Hs02_00335289 predicted 1994
8 SASI_Hs01_00091312 predicted 364
9 SASI_Hs01_00091314 predicted 1578
10 SASI_Hs02_00335290 predicted 569
11 SASI_Hs01_00091306 predicted 1982
12 SASI_Hs01_00091313 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269175 predicted 991
2 SASI_Rn01_00102818 predicted 795
3 SASI_Rn01_00102819 predicted 587
4 SASI_Rn01_00102820 predicted 781
5 SASI_Rn01_00102821 predicted 1654
6 SASI_Rn01_00102822 predicted 1474
7 SASI_Rn01_00102823 predicted 1955
8 SASI_Rn02_00269176 predicted 221
9 SASI_Rn01_00102824 predicted 561
10 SASI_Rn01_00102825 predicted 311
11 SASI_Rn01_00102816 predicted 361
12 SASI_Rn01_00102817 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135030 predicted 1929
2 SASI_Mm01_00135031 predicted 1332
3 SASI_Mm01_00135033 predicted 1923
4 SASI_Mm01_00135034 predicted 571
5 SASI_Mm01_00135035 predicted 425
6 SASI_Mm01_00135036 predicted 1950
7 SASI_Mm02_00326626 predicted 1749
8 SASI_Mm01_00135038 predicted 543
9 SASI_Mm01_00135039 predicted 283
10 SASI_Mm02_00326627 predicted 771
11 SASI_Mm01_00135032 predicted 778
12 SASI_Mm01_00135037 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003249
VALIDATED
THOP1 MISSION shRNA Bacterial Glycerol Stock
thimet oligopeptidase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-677s1c1
Sequence:CCGGGTGCATCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003249.3-2069s1c1
Sequence:CCGGCATGGATTACAGAAGCTGCATCTCGAGATGCAGCTTCTGTAATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-1560s1c1
Sequence:CCGGGAGACCTACTTCCATGAGTTTCTCGAGAAACTCATGGAAGTAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003249.3-376s1c1
Sequence:CCGGCCTACACAGTTCAGAGGAATACTCGAGTATTCCTCTGAACTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-2000s1c1
Sequence:CCGGCGAGGTGTATTCCATGGACATCTCGAGATGTCCATGGAATACACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-905s21c1
Sequence:CCGGGGAGAACTGCGCTATCCTCAACTCGAGTTGAGGATAGCGCAGTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-796s21c1
Sequence:CCGGAGTTGAAGGTCACCCTCAAGTCTCGAGACTTGAGGGTGACCTTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-201s21c1
Sequence:CCGGTCTCCGTGCTCTGTGGTAAACCTCGAGGTTTACCACAGAGCACGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003249
VALIDATED
THOP1 MISSION shRNA shRNA Plasmid DNA
thimet oligopeptidase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-677s1c1
Sequence:CCGGGTGCATCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003249.3-2069s1c1
Sequence:CCGGCATGGATTACAGAAGCTGCATCTCGAGATGCAGCTTCTGTAATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-1560s1c1
Sequence:CCGGGAGACCTACTTCCATGAGTTTCTCGAGAAACTCATGGAAGTAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003249.3-376s1c1
Sequence:CCGGCCTACACAGTTCAGAGGAATACTCGAGTATTCCTCTGAACTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-2000s1c1
Sequence:CCGGCGAGGTGTATTCCATGGACATCTCGAGATGTCCATGGAATACACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-905s21c1
Sequence:CCGGGGAGAACTGCGCTATCCTCAACTCGAGTTGAGGATAGCGCAGTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-796s21c1
Sequence:CCGGAGTTGAAGGTCACCCTCAAGTCTCGAGACTTGAGGGTGACCTTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-201s21c1
Sequence:CCGGTCTCCGTGCTCTGTGGTAAACCTCGAGGTTTACCACAGAGCACGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003249
VALIDATED
THOP1 MISSION shRNA Lentiviral Transduction Particles
thimet oligopeptidase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-677s1c1
Sequence:CCGGGTGCATCGACTTCAACAAGAACTCGAGTTCTTGTTGAAGTCGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003249.3-2069s1c1
Sequence:CCGGCATGGATTACAGAAGCTGCATCTCGAGATGCAGCTTCTGTAATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-1560s1c1
Sequence:CCGGGAGACCTACTTCCATGAGTTTCTCGAGAAACTCATGGAAGTAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003249.3-376s1c1
Sequence:CCGGCCTACACAGTTCAGAGGAATACTCGAGTATTCCTCTGAACTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003249.3-2000s1c1
Sequence:CCGGCGAGGTGTATTCCATGGACATCTCGAGATGTCCATGGAATACACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-905s21c1
Sequence:CCGGGGAGAACTGCGCTATCCTCAACTCGAGTTGAGGATAGCGCAGTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-796s21c1
Sequence:CCGGAGTTGAAGGTCACCCTCAAGTCTCGAGACTTGAGGGTGACCTTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003249.3-201s21c1
Sequence:CCGGTCTCCGTGCTCTGTGGTAAACCTCGAGGTTTACCACAGAGCACGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022653
VALIDATED
THOP1 MISSION shRNA Bacterial Glycerol Stock
thimet oligopeptidase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-345s1c1
Sequence:CCGGGCAGAGGAACATTCTCGACTTCTCGAGAAGTCGAGAATGTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-1933s1c1
Sequence:CCGGGCTCAGTACTATGGCTACTTACTCGAGTAAGTAGCCATAGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-1959s1c1
Sequence:CCGGCGAAGTGTACTCGATGGACATCTCGAGATGTCCATCGAGTACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-768s1c1
Sequence:CCGGCCTCAAGTACCCTCACTACTTCTCGAGAAGTAGTGAGGGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-790s1c1
Sequence:CCGGCCGCTGTTGAAGAAGTGCCATCTCGAGATGGCACTTCTTCAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-767s21c1
Sequence:CCGGCCTCAAGTACCCTCACTACTTCTCGAGAAGTAGTGAGGGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-344s21c1
Sequence:CCGGGCAGAGGAACATTCTCGACTTCTCGAGAAGTCGAGAATGTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-1958s21c1
Sequence:CCGGCGAAGTGTACTCGATGGACATCTCGAGATGTCCATCGAGTACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-1932s21c1
Sequence:CCGGGCTCAGTACTATGGCTACTTACTCGAGTAAGTAGCCATAGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022653
VALIDATED
THOP1 MISSION shRNA shRNA Plasmid DNA
thimet oligopeptidase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-345s1c1
Sequence:CCGGGCAGAGGAACATTCTCGACTTCTCGAGAAGTCGAGAATGTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-1933s1c1
Sequence:CCGGGCTCAGTACTATGGCTACTTACTCGAGTAAGTAGCCATAGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-1959s1c1
Sequence:CCGGCGAAGTGTACTCGATGGACATCTCGAGATGTCCATCGAGTACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-768s1c1
Sequence:CCGGCCTCAAGTACCCTCACTACTTCTCGAGAAGTAGTGAGGGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-790s1c1
Sequence:CCGGCCGCTGTTGAAGAAGTGCCATCTCGAGATGGCACTTCTTCAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-767s21c1
Sequence:CCGGCCTCAAGTACCCTCACTACTTCTCGAGAAGTAGTGAGGGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-344s21c1
Sequence:CCGGGCAGAGGAACATTCTCGACTTCTCGAGAAGTCGAGAATGTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-1958s21c1
Sequence:CCGGCGAAGTGTACTCGATGGACATCTCGAGATGTCCATCGAGTACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-1932s21c1
Sequence:CCGGGCTCAGTACTATGGCTACTTACTCGAGTAAGTAGCCATAGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022653
VALIDATED
THOP1 MISSION shRNA Lentiviral Transduction Particles
thimet oligopeptidase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-345s1c1
Sequence:CCGGGCAGAGGAACATTCTCGACTTCTCGAGAAGTCGAGAATGTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-1933s1c1
Sequence:CCGGGCTCAGTACTATGGCTACTTACTCGAGTAAGTAGCCATAGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-1959s1c1
Sequence:CCGGCGAAGTGTACTCGATGGACATCTCGAGATGTCCATCGAGTACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-768s1c1
Sequence:CCGGCCTCAAGTACCCTCACTACTTCTCGAGAAGTAGTGAGGGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022653.2-790s1c1
Sequence:CCGGCCGCTGTTGAAGAAGTGCCATCTCGAGATGGCACTTCTTCAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-767s21c1
Sequence:CCGGCCTCAAGTACCCTCACTACTTCTCGAGAAGTAGTGAGGGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-344s21c1
Sequence:CCGGGCAGAGGAACATTCTCGACTTCTCGAGAAGTCGAGAATGTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-1958s21c1
Sequence:CCGGCGAAGTGTACTCGATGGACATCTCGAGATGTCCATCGAGTACACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022653.3-1932s21c1
Sequence:CCGGGCTCAGTACTATGGCTACTTACTCGAGTAAGTAGCCATAGTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks