EMAIL THIS PAGE TO A FRIEND

THPO

thrombopoietin

Synonyms: MGDF MKCSF ML MPLLG THCYT1 TPO
Gene ID:
Human(7066) Summary: Megakaryocytopoiesis is the cellular development process that leads to platelet production. The protein encoded by this gene is a humoral growth factor that is necessary for megakaryocyte proliferation and maturation, as well as for thrombopoiesis. This protein is the ligand for MLP/C_MPL, the product of myeloproliferative leukemia virus oncogene. Mutations in this gene are the cause of thrombocythemia 1. Alternate splicing results in multiple transcript variants of this gene.[provided by RefSeq, Jun 2012]
Mouse(21832) thrombopoietin
Rat(81811) thrombopoietin
Zebrafish(100189608) thrombopoietin
dog(607489) thrombopoietin
domestic cat(100302539) thrombopoietin
chicken(414803) thrombopoietin
naked mole-rat(101705058) thrombopoietin
cow(538672) thrombopoietin
sheep(101119601) thrombopoietin
Gene Class: Cytokines_and_Chemokines
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000460 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000460 Rosetta Predictions human pricing
NM_199228 Rosetta Predictions human pricing
NM_199356 Rosetta Predictions human pricing
NM_031133 Rosetta Predictions rat pricing
NM_009379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302597 predicted 1028
2 SASI_Hs02_00302598 predicted 460
3 SASI_Hs01_00144953 predicted 1336
4 SASI_Hs01_00144955 predicted 1291
5 SASI_Hs01_00144956 predicted 225
6 SASI_Hs01_00144957 predicted 217
7 SASI_Hs02_00302599 predicted 1224
8 SASI_Hs02_00302600 predicted 1518
9 SASI_Hs02_00302601 predicted 1235
10 SASI_Hs02_00302602 predicted 792
11 SASI_Hs01_00144949 predicted 236
12 SASI_Hs01_00144950 predicted 1400
13 SASI_Hs01_00144951 predicted 1494
14 SASI_Hs01_00144952 predicted 1114
15 SASI_Hs01_00144954 predicted 330
16 SASI_Hs01_00144958 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215947 predicted 244
2 SASI_Hs01_00215948 predicted 1388
3 SASI_Hs01_00215949 predicted 1488
4 SASI_Hs01_00215950 predicted 1101
5 SASI_Hs01_00215951 predicted 1337
6 SASI_Hs01_00215952 predicted 327
7 SASI_Hs01_00215953 predicted 1284
8 SASI_Hs01_00215954 predicted 233
9 SASI_Hs01_00215955 predicted 223
10 SASI_Hs01_00215956 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076982 predicted 239
2 SASI_Hs01_00076983 predicted 1285
3 SASI_Hs01_00076984 predicted 1386
4 SASI_Hs01_00076985 predicted 997
5 SASI_Hs01_00076986 predicted 1233
6 SASI_Hs01_00076987 predicted 332
7 SASI_Hs01_00076988 predicted 1181
8 SASI_Hs01_00076989 predicted 231
9 SASI_Hs01_00076990 predicted 227
10 SASI_Hs01_00076991 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087825 predicted 734
2 SASI_Rn01_00087826 predicted 725
3 SASI_Rn01_00087827 predicted 983
4 SASI_Rn01_00087829 predicted 320
5 SASI_Rn01_00087830 predicted 309
6 SASI_Rn01_00087831 predicted 903
7 SASI_Rn01_00087832 predicted 841
8 SASI_Rn01_00087833 predicted 892
9 SASI_Rn01_00087834 predicted 761
10 SASI_Rn02_00264459 predicted 758
11 SASI_Rn01_00087828 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162847 predicted 1896
2 SASI_Mm01_00162848 predicted 959
3 SASI_Mm01_00162849 predicted 1924
4 SASI_Mm01_00162850 predicted 1888
5 SASI_Mm01_00162851 predicted 1886
6 SASI_Mm01_00162852 predicted 1209
7 SASI_Mm01_00162853 predicted 1888
8 SASI_Mm01_00162854 predicted 1947
9 SASI_Mm01_00162855 predicted 1901
10 SASI_Mm01_00162856 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000460
THPO MISSION shRNA Bacterial Glycerol Stock
thrombopoietin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000460.2-1073s21c1
Sequence:CCGGCAACCTCCAGCCTGGATATTCCTCGAGGAATATCCAGGCTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000460.2-1496s21c1
Sequence:CCGGAGCTAGCTCTTTGGTCTATTTCTCGAGAAATAGACCAAAGAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000460.2-300s21c1
Sequence:CCGGGACCTCCGAGTCCTCAGTAAACTCGAGTTTACTGAGGACTCGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1223s1c1
Sequence:CCGGCCCTCTTCTAAACACATCCTACTCGAGTAGGATGTGTTTAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1030s1c1
Sequence:CCGGCGGACATTTCCTCAGGAACATCTCGAGATGTTCCTGAGGAAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-249s1c1
Sequence:CCGGCTTCTCCTAACTGCAAGGCTACTCGAGTAGCCTTGCAGTTAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1219s1c1
Sequence:CCGGCCAGCCCTCTTCTAAACACATCTCGAGATGTGTTTAGAAGAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-680s1c1
Sequence:CCGGGCTCCGAGGAAAGGTGCGTTTCTCGAGAAACGCACCTTTCCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000460
THPO MISSION shRNA shRNA Plasmid DNA
thrombopoietin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000460.2-1073s21c1
Sequence:CCGGCAACCTCCAGCCTGGATATTCCTCGAGGAATATCCAGGCTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000460.2-1496s21c1
Sequence:CCGGAGCTAGCTCTTTGGTCTATTTCTCGAGAAATAGACCAAAGAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000460.2-300s21c1
Sequence:CCGGGACCTCCGAGTCCTCAGTAAACTCGAGTTTACTGAGGACTCGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1223s1c1
Sequence:CCGGCCCTCTTCTAAACACATCCTACTCGAGTAGGATGTGTTTAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1030s1c1
Sequence:CCGGCGGACATTTCCTCAGGAACATCTCGAGATGTTCCTGAGGAAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-249s1c1
Sequence:CCGGCTTCTCCTAACTGCAAGGCTACTCGAGTAGCCTTGCAGTTAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1219s1c1
Sequence:CCGGCCAGCCCTCTTCTAAACACATCTCGAGATGTGTTTAGAAGAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-680s1c1
Sequence:CCGGGCTCCGAGGAAAGGTGCGTTTCTCGAGAAACGCACCTTTCCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000460
THPO MISSION shRNA Lentiviral Transduction Particles
thrombopoietin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000460.2-1073s21c1
Sequence:CCGGCAACCTCCAGCCTGGATATTCCTCGAGGAATATCCAGGCTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000460.2-1496s21c1
Sequence:CCGGAGCTAGCTCTTTGGTCTATTTCTCGAGAAATAGACCAAAGAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000460.2-300s21c1
Sequence:CCGGGACCTCCGAGTCCTCAGTAAACTCGAGTTTACTGAGGACTCGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1223s1c1
Sequence:CCGGCCCTCTTCTAAACACATCCTACTCGAGTAGGATGTGTTTAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1030s1c1
Sequence:CCGGCGGACATTTCCTCAGGAACATCTCGAGATGTTCCTGAGGAAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-249s1c1
Sequence:CCGGCTTCTCCTAACTGCAAGGCTACTCGAGTAGCCTTGCAGTTAGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-1219s1c1
Sequence:CCGGCCAGCCCTCTTCTAAACACATCTCGAGATGTGTTTAGAAGAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000460.2-680s1c1
Sequence:CCGGGCTCCGAGGAAAGGTGCGTTTCTCGAGAAACGCACCTTTCCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009379
VALIDATED
THPO MISSION shRNA Bacterial Glycerol Stock
thrombopoietin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1415s21c1
Sequence:CCGGCCAGTCACAATGTACCCTCATCTCGAGATGAGGGTACATTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1054s21c1
Sequence:CCGGGCTTCAGGGATTCAGAGTCAACTCGAGTTGACTCTGAATCCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-553s21c1
Sequence:CCGGCCCTTTGTCTATCCCTGTTCTCTCGAGAGAACAGGGATAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1111s21c1
Sequence:CCGGCCCAGTCCAAATCTCTGGATACTCGAGTATCCAGAGATTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-1112s1c1
Sequence:CCGGCCCAGTCCAAATCTCTGGATACTCGAGTATCCAGAGATTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-1416s1c1
Sequence:CCGGCCAGTCACAATGTACCCTCATCTCGAGATGAGGGTACATTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-962s1c1
Sequence:CCGGCACACTAAACAAGTTCCCAAACTCGAGTTTGGGAACTTGTTTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-554s1c1
Sequence:CCGGCCCTTTGTCTATCCCTGTTCTCTCGAGAGAACAGGGATAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009379.2-1055s1c1
Sequence:CCGGGCTTCAGGGATTCAGAGTCAACTCGAGTTGACTCTGAATCCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009379
VALIDATED
THPO MISSION shRNA shRNA Plasmid DNA
thrombopoietin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1415s21c1
Sequence:CCGGCCAGTCACAATGTACCCTCATCTCGAGATGAGGGTACATTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1054s21c1
Sequence:CCGGGCTTCAGGGATTCAGAGTCAACTCGAGTTGACTCTGAATCCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-553s21c1
Sequence:CCGGCCCTTTGTCTATCCCTGTTCTCTCGAGAGAACAGGGATAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1111s21c1
Sequence:CCGGCCCAGTCCAAATCTCTGGATACTCGAGTATCCAGAGATTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-1112s1c1
Sequence:CCGGCCCAGTCCAAATCTCTGGATACTCGAGTATCCAGAGATTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-1416s1c1
Sequence:CCGGCCAGTCACAATGTACCCTCATCTCGAGATGAGGGTACATTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-962s1c1
Sequence:CCGGCACACTAAACAAGTTCCCAAACTCGAGTTTGGGAACTTGTTTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-554s1c1
Sequence:CCGGCCCTTTGTCTATCCCTGTTCTCTCGAGAGAACAGGGATAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009379.2-1055s1c1
Sequence:CCGGGCTTCAGGGATTCAGAGTCAACTCGAGTTGACTCTGAATCCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009379
VALIDATED
THPO MISSION shRNA Lentiviral Transduction Particles
thrombopoietin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1415s21c1
Sequence:CCGGCCAGTCACAATGTACCCTCATCTCGAGATGAGGGTACATTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1054s21c1
Sequence:CCGGGCTTCAGGGATTCAGAGTCAACTCGAGTTGACTCTGAATCCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-553s21c1
Sequence:CCGGCCCTTTGTCTATCCCTGTTCTCTCGAGAGAACAGGGATAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009379.3-1111s21c1
Sequence:CCGGCCCAGTCCAAATCTCTGGATACTCGAGTATCCAGAGATTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-1112s1c1
Sequence:CCGGCCCAGTCCAAATCTCTGGATACTCGAGTATCCAGAGATTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-1416s1c1
Sequence:CCGGCCAGTCACAATGTACCCTCATCTCGAGATGAGGGTACATTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-962s1c1
Sequence:CCGGCACACTAAACAAGTTCCCAAACTCGAGTTTGGGAACTTGTTTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009379.2-554s1c1
Sequence:CCGGCCCTTTGTCTATCCCTGTTCTCTCGAGAGAACAGGGATAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009379.2-1055s1c1
Sequence:CCGGGCTTCAGGGATTCAGAGTCAACTCGAGTTGACTCTGAATCCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks