EMAIL THIS PAGE TO A FRIEND

THRA

thyroid hormone receptor, alpha

Synonyms: AR7 CHNG6 EAR7 ERB-T-1 ERBA ERBA1 NR1A1 THRA1 THRA2 c-ERBA-1
UniProtKB ID: P10827, A8K3B5, P21205, Q8N6A1, Q96H73
Gene ID:
Human(7067) Summary: The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(21833) thyroid hormone receptor alpha
Rat(81812) thyroid hormone receptor alpha
chicken(396251) thyroid hormone receptor, alpha
domestic cat(101095056) thyroid hormone receptor, alpha
dog(403601) thyroid hormone receptor, alpha
cow(532621) thyroid hormone receptor, alpha
sheep(443446) thyroid hormone receptor, alpha
naked mole-rat(101726699) thyroid hormone receptor, alpha
Domestic Rabbit(100303772) thyroid hormone receptor, alpha
domestic guinea pig(100726737) thyroid hormone receptor, alpha
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003250 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003250 siRNAs that have been validated in the lab human pricing
NM_199334 Rosetta Predictions human pricing
NM_001017960 Rosetta Predictions rat pricing
NM_031134 Rosetta Predictions rat pricing
NM_178060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003250 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243562 validated 1120
1 SASI_Hs01_00243564 validated 596
2 SASI_Hs01_00243563 predicted 1037
3 SASI_Hs01_00243565 predicted 1042
4 SASI_Hs01_00243566 predicted 727
5 SASI_Hs01_00243567 predicted 593
6 SASI_Hs01_00243569 predicted 960
7 SASI_Hs01_00243570 predicted 951
8 SASI_Hs01_00243571 predicted 697
9 SASI_Hs02_00335291 predicted 1067
10 SASI_Hs01_00243568 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020052 predicted 1215
2 SASI_Hs01_00020053 predicted 1138
3 SASI_Hs01_00020054 predicted 691
4 SASI_Hs01_00020055 predicted 1143
5 SASI_Hs01_00020056 predicted 823
6 SASI_Hs01_00020057 predicted 697
7 SASI_Hs01_00020059 predicted 1055
8 SASI_Hs01_00020060 predicted 1049
9 SASI_Hs01_00020061 predicted 795
10 SASI_Hs02_00372765 predicted 1165
11 SASI_Hs01_00020058 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088648 predicted 687
2 SASI_Rn01_00088649 predicted 1301
3 SASI_Rn01_00088650 predicted 980
4 SASI_Rn01_00088651 predicted 607
5 SASI_Rn01_00088652 predicted 1015
6 SASI_Rn01_00088653 predicted 1221
7 SASI_Rn01_00088654 predicted 677
8 SASI_Rn01_00088656 predicted 1045
9 SASI_Rn01_00088657 predicted 797
10 SASI_Rn02_00202360 predicted 1322
11 SASI_Rn01_00088655 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106377 predicted 560
2 SASI_Rn01_00106378 predicted 1170
3 SASI_Rn01_00106379 predicted 849
4 SASI_Rn01_00106380 predicted 477
5 SASI_Rn01_00106381 predicted 876
6 SASI_Rn01_00106382 predicted 1091
7 SASI_Rn01_00106383 predicted 542
8 SASI_Rn01_00106385 predicted 913
9 SASI_Rn01_00106386 predicted 670
10 SASI_Rn02_00264460 predicted 1187
11 SASI_Rn01_00106384 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071635 predicted 675
2 SASI_Mm01_00071636 predicted 692
3 SASI_Mm01_00071637 predicted 1840
4 SASI_Mm01_00071638 predicted 978
5 SASI_Mm01_00071639 predicted 608
6 SASI_Mm01_00071640 predicted 1008
7 SASI_Mm01_00071641 predicted 924
8 SASI_Mm01_00071642 predicted 1319
9 SASI_Mm01_00071643 predicted 1041
10 SASI_Mm01_00071644 predicted 1496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178060
VALIDATED
THRA MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-791s1c1
Sequence:CCGGGCCATGGACTTGGTTCTAGATCTCGAGATCTAGAACCAAGTCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178060.2-613s1c1
Sequence:CCGGCGGTTATCACTACCGCTGTATCTCGAGATACAGCGGTAGTGATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-758s1c1
Sequence:CCGGTGCCGCTTCAAGAAGTGCATTCTCGAGAATGCACTTCTTGAAGCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-1021s1c1
Sequence:CCGGCCAGTCACCTATTGTCTCCATCTCGAGATGGAGACAATAGGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-1637s1c1
Sequence:CCGGGAGGTCTTTGAGGATCAGGAACTCGAGTTCCTGATCCTCAAAGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-613s21c1
Sequence:CCGGCGGTTATCACTACCGCTGTATCTCGAGATACAGCGGTAGTGATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-539s21c1
Sequence:CCGGAGCAGCATGTCAGGGTATATCCTCGAGGATATACCCTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-1065s21c1
Sequence:CCGGTAGAGGCCTTCAGCGAGTTTACTCGAGTAAACTCGCTGAAGGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-1014s21c1
Sequence:CCGGACATTGGCCAGTCACCTATTGCTCGAGCAATAGGTGACTGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178060.3-1833s21c1
Sequence:CCGGCCCTTGGACAGGGCCATAAATCTCGAGATTTATGGCCCTGTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178060
VALIDATED
THRA MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-791s1c1
Sequence:CCGGGCCATGGACTTGGTTCTAGATCTCGAGATCTAGAACCAAGTCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178060.2-613s1c1
Sequence:CCGGCGGTTATCACTACCGCTGTATCTCGAGATACAGCGGTAGTGATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-758s1c1
Sequence:CCGGTGCCGCTTCAAGAAGTGCATTCTCGAGAATGCACTTCTTGAAGCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-1021s1c1
Sequence:CCGGCCAGTCACCTATTGTCTCCATCTCGAGATGGAGACAATAGGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-1637s1c1
Sequence:CCGGGAGGTCTTTGAGGATCAGGAACTCGAGTTCCTGATCCTCAAAGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-613s21c1
Sequence:CCGGCGGTTATCACTACCGCTGTATCTCGAGATACAGCGGTAGTGATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-539s21c1
Sequence:CCGGAGCAGCATGTCAGGGTATATCCTCGAGGATATACCCTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-1065s21c1
Sequence:CCGGTAGAGGCCTTCAGCGAGTTTACTCGAGTAAACTCGCTGAAGGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-1014s21c1
Sequence:CCGGACATTGGCCAGTCACCTATTGCTCGAGCAATAGGTGACTGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178060.3-1833s21c1
Sequence:CCGGCCCTTGGACAGGGCCATAAATCTCGAGATTTATGGCCCTGTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178060
VALIDATED
THRA MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-791s1c1
Sequence:CCGGGCCATGGACTTGGTTCTAGATCTCGAGATCTAGAACCAAGTCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178060.2-613s1c1
Sequence:CCGGCGGTTATCACTACCGCTGTATCTCGAGATACAGCGGTAGTGATAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-758s1c1
Sequence:CCGGTGCCGCTTCAAGAAGTGCATTCTCGAGAATGCACTTCTTGAAGCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-1021s1c1
Sequence:CCGGCCAGTCACCTATTGTCTCCATCTCGAGATGGAGACAATAGGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178060.2-1637s1c1
Sequence:CCGGGAGGTCTTTGAGGATCAGGAACTCGAGTTCCTGATCCTCAAAGACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-613s21c1
Sequence:CCGGCGGTTATCACTACCGCTGTATCTCGAGATACAGCGGTAGTGATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-539s21c1
Sequence:CCGGAGCAGCATGTCAGGGTATATCCTCGAGGATATACCCTGACATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-1065s21c1
Sequence:CCGGTAGAGGCCTTCAGCGAGTTTACTCGAGTAAACTCGCTGAAGGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178060.3-1014s21c1
Sequence:CCGGACATTGGCCAGTCACCTATTGCTCGAGCAATAGGTGACTGGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178060.3-1833s21c1
Sequence:CCGGCCCTTGGACAGGGCCATAAATCTCGAGATTTATGGCCCTGTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003250
VALIDATED
THRA MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-885s1c1
Sequence:CCGGGCGTAAGCTGATTGAGCAGAACTCGAGTTCTGCTCAATCAGCTTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-600s1c1
Sequence:CCGGGTCAGGGTATATCCCTAGTTACTCGAGTAACTAGGGATATACCCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-1551s1c1
Sequence:CCGGCAAACACAACATTCCGCACTTCTCGAGAAGTGCGGAATGTTGTGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-543s1c1
Sequence:CCGGGTCACCAGATGGAAAGCGAAACTCGAGTTTCGCTTTCCATCTGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003250.4-1128s1c1
Sequence:CCGGCAGCGAGTTTACCAAGATCATCTCGAGATGATCTTGGTAAACTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-543s21c1
Sequence:CCGGGTCACCAGATGGAAAGCGAAACTCGAGTTTCGCTTTCCATCTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-600s21c1
Sequence:CCGGGTCAGGGTATATCCCTAGTTACTCGAGTAACTAGGGATATACCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-885s21c1
Sequence:CCGGGCGTAAGCTGATTGAGCAGAACTCGAGTTCTGCTCAATCAGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-1128s21c1
Sequence:CCGGCAGCGAGTTTACCAAGATCATCTCGAGATGATCTTGGTAAACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003250
VALIDATED
THRA MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-885s1c1
Sequence:CCGGGCGTAAGCTGATTGAGCAGAACTCGAGTTCTGCTCAATCAGCTTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-600s1c1
Sequence:CCGGGTCAGGGTATATCCCTAGTTACTCGAGTAACTAGGGATATACCCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-1551s1c1
Sequence:CCGGCAAACACAACATTCCGCACTTCTCGAGAAGTGCGGAATGTTGTGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-543s1c1
Sequence:CCGGGTCACCAGATGGAAAGCGAAACTCGAGTTTCGCTTTCCATCTGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003250.4-1128s1c1
Sequence:CCGGCAGCGAGTTTACCAAGATCATCTCGAGATGATCTTGGTAAACTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-543s21c1
Sequence:CCGGGTCACCAGATGGAAAGCGAAACTCGAGTTTCGCTTTCCATCTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-600s21c1
Sequence:CCGGGTCAGGGTATATCCCTAGTTACTCGAGTAACTAGGGATATACCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-885s21c1
Sequence:CCGGGCGTAAGCTGATTGAGCAGAACTCGAGTTCTGCTCAATCAGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-1128s21c1
Sequence:CCGGCAGCGAGTTTACCAAGATCATCTCGAGATGATCTTGGTAAACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003250
VALIDATED
THRA MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-885s1c1
Sequence:CCGGGCGTAAGCTGATTGAGCAGAACTCGAGTTCTGCTCAATCAGCTTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-600s1c1
Sequence:CCGGGTCAGGGTATATCCCTAGTTACTCGAGTAACTAGGGATATACCCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-1551s1c1
Sequence:CCGGCAAACACAACATTCCGCACTTCTCGAGAAGTGCGGAATGTTGTGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003250.4-543s1c1
Sequence:CCGGGTCACCAGATGGAAAGCGAAACTCGAGTTTCGCTTTCCATCTGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003250.4-1128s1c1
Sequence:CCGGCAGCGAGTTTACCAAGATCATCTCGAGATGATCTTGGTAAACTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-543s21c1
Sequence:CCGGGTCACCAGATGGAAAGCGAAACTCGAGTTTCGCTTTCCATCTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-600s21c1
Sequence:CCGGGTCAGGGTATATCCCTAGTTACTCGAGTAACTAGGGATATACCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-885s21c1
Sequence:CCGGGCGTAAGCTGATTGAGCAGAACTCGAGTTCTGCTCAATCAGCTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003250.4-1128s21c1
Sequence:CCGGCAGCGAGTTTACCAAGATCATCTCGAGATGATCTTGGTAAACTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks