EMAIL THIS PAGE TO A FRIEND

THRAP3

thyroid hormone receptor associated protein 3

Synonyms: TRAP150
UniProtKB ID: Q9Y2W1, D3DPS5, Q5VTK6
Gene ID:
Mouse(230753) thyroid hormone receptor associated protein 3
Rat(313591) thyroid hormone receptor associated protein 3
chicken(419623) thyroid hormone receptor associated protein 3
dog(482476) thyroid hormone receptor associated protein 3
Horse(100055016) thyroid hormone receptor associated protein 3
domestic cat(101088597) thyroid hormone receptor associated protein 3
domestic guinea pig(100733607) thyroid hormone receptor associated protein 3
Domestic Rabbit(100346054) thyroid hormone receptor associated protein 3
naked mole-rat(101719605) thyroid hormone receptor associated protein 3
cow(505228) thyroid hormone receptor associated protein 3
sheep(101113021) thyroid hormone receptor associated protein 3
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005119 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056331 MISSION® esiRNA esiRNA human THRAP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005119 Rosetta Predictions human pricing
NM_001009693 Rosetta Predictions rat pricing
NM_146153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080496 predicted 429
2 SASI_Hs02_00339016 predicted 814
3 SASI_Hs01_00080497 predicted 1629
4 SASI_Hs01_00080498 predicted 399
5 SASI_Hs01_00080499 predicted 267
6 SASI_Hs01_00080500 predicted 2057
7 SASI_Hs01_00080503 predicted 1251
8 SASI_Hs02_00339017 predicted 656
9 SASI_Hs02_00339018 predicted 2664
10 SASI_Hs02_00339019 predicted 1581
11 SASI_Hs01_00080495 predicted 2341
12 SASI_Hs01_00080501 predicted 2350
13 SASI_Hs01_00080502 predicted 2830
14 SASI_Hs01_00080504 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063043 predicted 2084
2 SASI_Rn01_00063044 predicted 370
3 SASI_Rn01_00063045 predicted 2678
4 SASI_Rn01_00063046 predicted 2045
5 SASI_Rn01_00063047 predicted 656
6 SASI_Rn02_00199753 predicted 1135
7 SASI_Rn01_00063048 predicted 574
8 SASI_Rn01_00063050 predicted 966
9 SASI_Rn01_00063051 predicted 2339
10 SASI_Rn01_00063052 predicted 1314
11 SASI_Rn01_00063049 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049232 predicted 2097
2 SASI_Mm01_00049234 predicted 362
3 SASI_Mm01_00049235 predicted 1129
4 SASI_Mm01_00049237 predicted 2046
5 SASI_Mm01_00049238 predicted 1475
6 SASI_Mm01_00049239 predicted 1493
7 SASI_Mm02_00341840 predicted 2217
8 SASI_Mm01_00049240 predicted 1378
9 SASI_Mm01_00049241 predicted 1481
10 SASI_Mm02_00341841 predicted 1981
11 SASI_Mm01_00049233 predicted 1222
12 SASI_Mm01_00049236 predicted 2119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146153
VALIDATED
THRAP3 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor associated protein 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-259s21c1
Sequence:CCGGGCCGATCTGTCTCTCGTTCAACTCGAGTTGAACGAGAGACAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-315s21c1
Sequence:CCGGTCATATTCTCCAGCTCATAACCTCGAGGTTATGAGCTGGAGAATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146153.3-392s21c1
Sequence:CCGGAGGCTACAGGAGGCCCTATTACTCGAGTAATAGGGCCTCCTGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-782s21c1
Sequence:CCGGAGGCACCTCTCAAGATATAAACTCGAGTTTATATCTTGAGAGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146153.3-479s21c1
Sequence:CCGGCCGTTCCAATTGGCAGAACTACTCGAGTAGTTCTGCCAATTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-2768s21c1
Sequence:CCGGGCCCAAGAGCAAGAAGTATTACTCGAGTAATACTTCTTGCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2031s1c1
Sequence:CCGGGCTCAGCACATAGTGACCATTCTCGAGAATGGTCACTATGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-479s1c1
Sequence:CCGGCCGTTCCAATTGGCAGAACTACTCGAGTAGTTCTGCCAATTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2768s1c1
Sequence:CCGGGCCCAAGAGCAAGAAGTATTACTCGAGTAATACTTCTTGCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2166s1c1
Sequence:CCGGCCAGAGATACACAGGAGGATACTCGAGTATCCTCCTGTGTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146153.3-3641s1c1
Sequence:CCGGCCCTTTCTACACAGCCATGTACTCGAGTACATGGCTGTGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146153
VALIDATED
THRAP3 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor associated protein 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-259s21c1
Sequence:CCGGGCCGATCTGTCTCTCGTTCAACTCGAGTTGAACGAGAGACAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-315s21c1
Sequence:CCGGTCATATTCTCCAGCTCATAACCTCGAGGTTATGAGCTGGAGAATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146153.3-392s21c1
Sequence:CCGGAGGCTACAGGAGGCCCTATTACTCGAGTAATAGGGCCTCCTGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-782s21c1
Sequence:CCGGAGGCACCTCTCAAGATATAAACTCGAGTTTATATCTTGAGAGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146153.3-479s21c1
Sequence:CCGGCCGTTCCAATTGGCAGAACTACTCGAGTAGTTCTGCCAATTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-2768s21c1
Sequence:CCGGGCCCAAGAGCAAGAAGTATTACTCGAGTAATACTTCTTGCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2031s1c1
Sequence:CCGGGCTCAGCACATAGTGACCATTCTCGAGAATGGTCACTATGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-479s1c1
Sequence:CCGGCCGTTCCAATTGGCAGAACTACTCGAGTAGTTCTGCCAATTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2768s1c1
Sequence:CCGGGCCCAAGAGCAAGAAGTATTACTCGAGTAATACTTCTTGCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2166s1c1
Sequence:CCGGCCAGAGATACACAGGAGGATACTCGAGTATCCTCCTGTGTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146153.3-3641s1c1
Sequence:CCGGCCCTTTCTACACAGCCATGTACTCGAGTACATGGCTGTGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146153
VALIDATED
THRAP3 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor associated protein 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-259s21c1
Sequence:CCGGGCCGATCTGTCTCTCGTTCAACTCGAGTTGAACGAGAGACAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-315s21c1
Sequence:CCGGTCATATTCTCCAGCTCATAACCTCGAGGTTATGAGCTGGAGAATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146153.3-392s21c1
Sequence:CCGGAGGCTACAGGAGGCCCTATTACTCGAGTAATAGGGCCTCCTGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-782s21c1
Sequence:CCGGAGGCACCTCTCAAGATATAAACTCGAGTTTATATCTTGAGAGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146153.3-479s21c1
Sequence:CCGGCCGTTCCAATTGGCAGAACTACTCGAGTAGTTCTGCCAATTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146153.3-2768s21c1
Sequence:CCGGGCCCAAGAGCAAGAAGTATTACTCGAGTAATACTTCTTGCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2031s1c1
Sequence:CCGGGCTCAGCACATAGTGACCATTCTCGAGAATGGTCACTATGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-479s1c1
Sequence:CCGGCCGTTCCAATTGGCAGAACTACTCGAGTAGTTCTGCCAATTGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2768s1c1
Sequence:CCGGGCCCAAGAGCAAGAAGTATTACTCGAGTAATACTTCTTGCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146153.3-2166s1c1
Sequence:CCGGCCAGAGATACACAGGAGGATACTCGAGTATCCTCCTGTGTATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146153.3-3641s1c1
Sequence:CCGGCCCTTTCTACACAGCCATGTACTCGAGTACATGGCTGTGTAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005119
VALIDATED
THRAP3 MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor associated protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-285s21c1
Sequence:CCGGAGATCTCGTTCTCGTTCATTTCTCGAGAAATGAACGAGAACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-3452s21c1
Sequence:CCGGTGGAGCTAAGATGACTAATTTCTCGAGAAATTAGTCATCTTAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005119.3-459s21c1
Sequence:CCGGGGCTATAGAAGGCCCTATTATCTCGAGATAATAGGGCCTTCTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-422s21c1
Sequence:CCGGAGTATATCAGAATCGGGATTTCTCGAGAAATCCCGATTCTGATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-2377s21c1
Sequence:CCGGGCCTTGATATTGAACGTCGTACTCGAGTACGACGTTCAATATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005119.1-2084s1c1
Sequence:CCGGGCCCAACATATAGTGACCATTCTCGAGAATGGTCACTATATGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005119.1-523s1c1
Sequence:CCGGCCGCTCAAATTGGCAGAATTACTCGAGTAATTCTGCCAATTTGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005119.1-1226s1c1
Sequence:CCGGGCAGCCTATACAAAGAGGTATCTCGAGATACCTCTTTGTATAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005119.1-2355s1c1
Sequence:CCGGGCCTTGATATTGAACGTCGTACTCGAGTACGACGTTCAATATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005119
VALIDATED
THRAP3 MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor associated protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-285s21c1
Sequence:CCGGAGATCTCGTTCTCGTTCATTTCTCGAGAAATGAACGAGAACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-3452s21c1
Sequence:CCGGTGGAGCTAAGATGACTAATTTCTCGAGAAATTAGTCATCTTAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005119.3-459s21c1
Sequence:CCGGGGCTATAGAAGGCCCTATTATCTCGAGATAATAGGGCCTTCTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-422s21c1
Sequence:CCGGAGTATATCAGAATCGGGATTTCTCGAGAAATCCCGATTCTGATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-2377s21c1
Sequence:CCGGGCCTTGATATTGAACGTCGTACTCGAGTACGACGTTCAATATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005119.1-2084s1c1
Sequence:CCGGGCCCAACATATAGTGACCATTCTCGAGAATGGTCACTATATGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005119.1-523s1c1
Sequence:CCGGCCGCTCAAATTGGCAGAATTACTCGAGTAATTCTGCCAATTTGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005119.1-1226s1c1
Sequence:CCGGGCAGCCTATACAAAGAGGTATCTCGAGATACCTCTTTGTATAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005119.1-2355s1c1
Sequence:CCGGGCCTTGATATTGAACGTCGTACTCGAGTACGACGTTCAATATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005119
VALIDATED
THRAP3 MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor associated protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-285s21c1
Sequence:CCGGAGATCTCGTTCTCGTTCATTTCTCGAGAAATGAACGAGAACGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-3452s21c1
Sequence:CCGGTGGAGCTAAGATGACTAATTTCTCGAGAAATTAGTCATCTTAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005119.3-459s21c1
Sequence:CCGGGGCTATAGAAGGCCCTATTATCTCGAGATAATAGGGCCTTCTATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-422s21c1
Sequence:CCGGAGTATATCAGAATCGGGATTTCTCGAGAAATCCCGATTCTGATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005119.3-2377s21c1
Sequence:CCGGGCCTTGATATTGAACGTCGTACTCGAGTACGACGTTCAATATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005119.1-2084s1c1
Sequence:CCGGGCCCAACATATAGTGACCATTCTCGAGAATGGTCACTATATGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005119.1-523s1c1
Sequence:CCGGCCGCTCAAATTGGCAGAATTACTCGAGTAATTCTGCCAATTTGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005119.1-1226s1c1
Sequence:CCGGGCAGCCTATACAAAGAGGTATCTCGAGATACCTCTTTGTATAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005119.1-2355s1c1
Sequence:CCGGGCCTTGATATTGAACGTCGTACTCGAGTACGACGTTCAATATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks