EMAIL THIS PAGE TO A FRIEND

THRB

thyroid hormone receptor, beta

Synonyms: C-ERBA-2 C-ERBA-BETA ERBA2 GRTH NR1A2 PRTH THR1 THRB1 THRB2
Gene ID:
Human(7068) Summary: The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
Mouse(21834) thyroid hormone receptor beta
Rat(24831) thyroid hormone receptor beta
Zebrafish(30607) thyroid hormone receptor beta
Horse(100051615) thyroid hormone receptor, beta
domestic cat(101084821) thyroid hormone receptor, beta
chicken(396431) thyroid hormone receptor, beta
dog(403599) thyroid hormone receptor, beta
cow(788329) thyroid hormone receptor, beta
naked mole-rat(101719651) thyroid hormone receptor, beta
Domestic Rabbit(100303763) thyroid hormone receptor, beta
domestic guinea pig(100721125) thyroid hormone receptor, beta
318 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504736 Anti-phospho-TR-β1 (pSer142) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB2102425 Anti-THRB (ab1) antibody produced in rabbit affinity isolated antibody horse, rabbit, rabbit, human, rat, sheep, mouse
western blot pricing
AV35635 Anti-THRB (AB1) antibody produced in rabbit affinity isolated antibody rabbit, mouse, rabbit, guinea pig, human, sheep, pig, rat, horse
western blot pricing
SAB2102426 Anti-THRB (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, mouse, rabbit, canine, rat, horse, sheep
western blot pricing
AV35636 Anti-THRB (AB2) antibody produced in rabbit affinity isolated antibody rabbit, pig, rabbit, guinea pig, canine, human, mouse, rat, horse
western blot pricing
SAB2501038 Anti-THRB antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, canine, mouse
ELISA, western blot pricing
AV36994 Anti-THRB antibody produced in rabbit IgG fraction of antiserum human, guinea pig, bovine, horse, mouse, rat
western blot pricing
HPA061035 Anti-THRB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105289 Anti-THRB, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
SAB4502969 Anti-Thyroid Hormone Receptor β, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
T7650 3,3′,5-Triiodothyroacetic acid ≥90% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000461 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083461 MISSION® esiRNA esiRNA human THRB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000461 Rosetta Predictions human pricing
NM_001128176 Rosetta Predictions human pricing
NM_001128177 Rosetta Predictions human pricing
NM_012672 Rosetta Predictions rat pricing
NM_001113417 Rosetta Predictions mouse pricing
NM_009380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103177 predicted 1556
2 SASI_Hs02_00302603 predicted 761
3 SASI_Hs01_00103178 predicted 756
4 SASI_Hs01_00103179 predicted 1238
5 SASI_Hs01_00103180 predicted 760
6 SASI_Hs01_00103181 predicted 1436
7 SASI_Hs01_00103183 predicted 1747
8 SASI_Hs01_00103184 predicted 1767
9 SASI_Hs01_00103185 predicted 1063
10 SASI_Hs01_00103186 predicted 1025
11 SASI_Hs01_00103182 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330736 predicted 1623
2 SASI_Hs02_00330737 predicted 827
3 SASI_Hs02_00330738 predicted 814
4 SASI_Hs02_00330739 predicted 1300
5 SASI_Hs02_00330740 predicted 830
6 SASI_Hs02_00330741 predicted 1504
7 SASI_Hs02_00330742 predicted 1815
8 SASI_Hs02_00330743 predicted 1825
9 SASI_Hs02_00330744 predicted 1124
10 SASI_Hs02_00330745 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330746 predicted 1688
2 SASI_Hs02_00330747 predicted 906
3 SASI_Hs02_00330748 predicted 887
4 SASI_Hs02_00330749 predicted 1371
5 SASI_Hs02_00330750 predicted 900
6 SASI_Hs02_00330751 predicted 1573
7 SASI_Hs02_00330752 predicted 1884
8 SASI_Hs02_00330753 predicted 1897
9 SASI_Hs02_00330754 predicted 1203
10 SASI_Hs02_00330755 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259943 predicted 592
2 SASI_Rn02_00259944 predicted 259
3 SASI_Rn01_00120886 predicted 519
4 SASI_Rn02_00259945 predicted 411
5 SASI_Rn01_00120887 predicted 235
6 SASI_Rn01_00120889 predicted 689
7 SASI_Rn01_00120890 predicted 1259
8 SASI_Rn01_00120892 predicted 609
9 SASI_Rn02_00259946 predicted 715
10 SASI_Rn02_00259947 predicted 296
11 SASI_Rn01_00120883 predicted 1686
12 SASI_Rn01_00120884 predicted 374
13 SASI_Rn01_00120885 predicted 704
14 SASI_Rn01_00120888 predicted 952
15 SASI_Rn01_00120891 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307836 predicted 679
2 SASI_Mm02_00307837 predicted 1343
3 SASI_Mm02_00307838 predicted 1673
4 SASI_Mm02_00307839 predicted 1389
5 SASI_Mm02_00307840 predicted 1225
6 SASI_Mm02_00307841 predicted 695
7 SASI_Mm02_00307842 predicted 757
8 SASI_Mm02_00307843 predicted 1139
9 SASI_Mm02_00307844 predicted 1393
10 SASI_Mm02_00307845 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057601 predicted 767
2 SASI_Mm01_00057606 predicted 1436
3 SASI_Mm02_00315989 predicted 1754
4 SASI_Mm01_00057607 predicted 1471
5 SASI_Mm01_00057608 predicted 1312
6 SASI_Mm01_00057609 predicted 776
7 SASI_Mm01_00057610 predicted 836
8 SASI_Mm02_00315990 predicted 1229
9 SASI_Mm02_00315991 predicted 1478
10 SASI_Mm02_00315992 predicted 1698
11 SASI_Mm01_00057602 predicted 371
12 SASI_Mm01_00057603 predicted 310
13 SASI_Mm01_00057604 predicted 867
14 SASI_Mm01_00057605 predicted 1540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009380
THRB MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-636s1c1
Sequence:CCGGCCCAGCTATTTAGACAAAGATCTCGAGATCTTTGTCTAAATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-434s1c1
Sequence:CCGGGCCCAGTAGCAGCATATATATCTCGAGATATATATGCTGCTACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-850s1c1
Sequence:CCGGGCATCTATGTTGGCATGGCAACTCGAGTTGCCATGCCAACATAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-1548s1c1
Sequence:CCGGGCCTTTGAACACTATATCAATCTCGAGATTGATATAGTGTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-761s1c1
Sequence:CCGGCCATCCATCTTATTCCTGTAACTCGAGTTACAGGAATAAGATGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009380
THRB MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-636s1c1
Sequence:CCGGCCCAGCTATTTAGACAAAGATCTCGAGATCTTTGTCTAAATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-434s1c1
Sequence:CCGGGCCCAGTAGCAGCATATATATCTCGAGATATATATGCTGCTACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-850s1c1
Sequence:CCGGGCATCTATGTTGGCATGGCAACTCGAGTTGCCATGCCAACATAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-1548s1c1
Sequence:CCGGGCCTTTGAACACTATATCAATCTCGAGATTGATATAGTGTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-761s1c1
Sequence:CCGGCCATCCATCTTATTCCTGTAACTCGAGTTACAGGAATAAGATGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009380
THRB MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-636s1c1
Sequence:CCGGCCCAGCTATTTAGACAAAGATCTCGAGATCTTTGTCTAAATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-434s1c1
Sequence:CCGGGCCCAGTAGCAGCATATATATCTCGAGATATATATGCTGCTACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-850s1c1
Sequence:CCGGGCATCTATGTTGGCATGGCAACTCGAGTTGCCATGCCAACATAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-1548s1c1
Sequence:CCGGGCCTTTGAACACTATATCAATCTCGAGATTGATATAGTGTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009380.1-761s1c1
Sequence:CCGGCCATCCATCTTATTCCTGTAACTCGAGTTACAGGAATAAGATGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000461
VALIDATED
THRB MISSION shRNA Bacterial Glycerol Stock
thyroid hormone receptor, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-1444s1c1
Sequence:CCGGGCCTGTGTTGAGAGAATAGAACTCGAGTTCTATTCTCTCAACACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-1641s1c1
Sequence:CCGGCCCTTTGTTCTTGGAAGTGTTCTCGAGAACACTTCCAAGAACAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-467s1c1
Sequence:CCGGCCACTTGGACTAGCTCAATATCTCGAGATATTGAGCTAGTCCAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000461.2-808s1c1
Sequence:CCGGGCAACAGATTTGGTGCTGGATCTCGAGATCCAGCACCAAATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-706s1c1
Sequence:CCGGCCATCCTATTCCTGTAAATATCTCGAGATATTTACAGGAATAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-765s21c1
Sequence:CCGGGTGCCAGGAATGTCGCTTTAACTCGAGTTAAAGCGACATTCCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-1444s21c1
Sequence:CCGGGCCTGTGTTGAGAGAATAGAACTCGAGTTCTATTCTCTCAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-468s21c1
Sequence:CCGGCACTTGGACTAGCTCAATATTCTCGAGAATATTGAGCTAGTCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-1037s21c1
Sequence:CCGGGACAAGCACCAATAGTCAATGCTCGAGCATTGACTATTGGTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000461.4-1838s21c1
Sequence:CCGGGTACTTGAAACTATTGCATTTCTCGAGAAATGCAATAGTTTCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000461
VALIDATED
THRB MISSION shRNA shRNA Plasmid DNA
thyroid hormone receptor, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-1444s1c1
Sequence:CCGGGCCTGTGTTGAGAGAATAGAACTCGAGTTCTATTCTCTCAACACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-1641s1c1
Sequence:CCGGCCCTTTGTTCTTGGAAGTGTTCTCGAGAACACTTCCAAGAACAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-467s1c1
Sequence:CCGGCCACTTGGACTAGCTCAATATCTCGAGATATTGAGCTAGTCCAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000461.2-808s1c1
Sequence:CCGGGCAACAGATTTGGTGCTGGATCTCGAGATCCAGCACCAAATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-706s1c1
Sequence:CCGGCCATCCTATTCCTGTAAATATCTCGAGATATTTACAGGAATAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-765s21c1
Sequence:CCGGGTGCCAGGAATGTCGCTTTAACTCGAGTTAAAGCGACATTCCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-1444s21c1
Sequence:CCGGGCCTGTGTTGAGAGAATAGAACTCGAGTTCTATTCTCTCAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-468s21c1
Sequence:CCGGCACTTGGACTAGCTCAATATTCTCGAGAATATTGAGCTAGTCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-1037s21c1
Sequence:CCGGGACAAGCACCAATAGTCAATGCTCGAGCATTGACTATTGGTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000461.4-1838s21c1
Sequence:CCGGGTACTTGAAACTATTGCATTTCTCGAGAAATGCAATAGTTTCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000461
VALIDATED
THRB MISSION shRNA Lentiviral Transduction Particles
thyroid hormone receptor, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-1444s1c1
Sequence:CCGGGCCTGTGTTGAGAGAATAGAACTCGAGTTCTATTCTCTCAACACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-1641s1c1
Sequence:CCGGCCCTTTGTTCTTGGAAGTGTTCTCGAGAACACTTCCAAGAACAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-467s1c1
Sequence:CCGGCCACTTGGACTAGCTCAATATCTCGAGATATTGAGCTAGTCCAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000461.2-808s1c1
Sequence:CCGGGCAACAGATTTGGTGCTGGATCTCGAGATCCAGCACCAAATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000461.2-706s1c1
Sequence:CCGGCCATCCTATTCCTGTAAATATCTCGAGATATTTACAGGAATAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-765s21c1
Sequence:CCGGGTGCCAGGAATGTCGCTTTAACTCGAGTTAAAGCGACATTCCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-1444s21c1
Sequence:CCGGGCCTGTGTTGAGAGAATAGAACTCGAGTTCTATTCTCTCAACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-468s21c1
Sequence:CCGGCACTTGGACTAGCTCAATATTCTCGAGAATATTGAGCTAGTCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000461.4-1037s21c1
Sequence:CCGGGACAAGCACCAATAGTCAATGCTCGAGCATTGACTATTGGTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000461.4-1838s21c1
Sequence:CCGGGTACTTGAAACTATTGCATTTCTCGAGAAATGCAATAGTTTCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks