EMAIL THIS PAGE TO A FRIEND

THRSP

thyroid hormone responsive

Synonyms: LPGP1 Lpgp S14 SPOT14 THRP
UniProtKB ID: Q92748, B2R4W7
Gene ID:
Human(7069) Summary: The protein encoded by this gene is similar to the gene product of S14, a rat gene whose expression is limited to liver and adipose tissue and is controlled by nutritional and hormonal factors. This gene has been shown to be expressed in liver and adipocytes, particularly in lipomatous modules. It is also found to be expressed in lipogenic breast cancers, which suggests a role in controlling tumor lipid metabolism. [provided by RefSeq, Jul 2008]
Mouse(21835) thyroid hormone responsive
Rat(25357) thyroid hormone responsive
Domestic Rabbit(100101618) thyroid hormone responsive
naked mole-rat(101716612) thyroid hormone responsive
domestic guinea pig(100736200) thyroid hormone responsive
cow(515940) thyroid hormone responsive
sheep(101110189) thyroid hormone responsive
chicken(404755) thyroid hormone responsive
dog(485169) thyroid hormone responsive
domestic cat(101086251) thyroid hormone responsive
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003251 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058381 MISSION® esiRNA esiRNA human THRSP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003251 Rosetta Predictions human pricing
NM_012703 Rosetta Predictions rat pricing
NM_009381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042542 predicted 436
2 SASI_Hs01_00042544 predicted 387
3 SASI_Hs02_00335292 predicted 436
4 SASI_Hs01_00042545 predicted 500
5 SASI_Hs01_00042546 predicted 468
6 SASI_Hs02_00335293 predicted 473
7 SASI_Hs01_00042547 predicted 479
8 SASI_Hs01_00042548 predicted 442
9 SASI_Hs02_00335294 predicted 444
10 SASI_Hs01_00042550 predicted 317
11 SASI_Hs01_00042543 predicted 286
12 SASI_Hs01_00042549 predicted 301
13 SASI_Hs01_00042551 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121505 predicted 817
2 SASI_Rn01_00121507 predicted 276
3 SASI_Rn01_00121508 predicted 634
4 SASI_Rn01_00121509 predicted 458
5 SASI_Rn01_00121510 predicted 461
6 SASI_Rn01_00121511 predicted 780
7 SASI_Rn01_00121512 predicted 648
8 SASI_Rn01_00121513 predicted 444
9 SASI_Rn01_00121514 predicted 653
10 SASI_Rn02_00260019 predicted 657
11 SASI_Rn01_00121506 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073594 predicted 250
2 SASI_Mm02_00315993 predicted 757
3 SASI_Mm01_00073586 predicted 695
4 SASI_Mm01_00073587 predicted 696
5 SASI_Mm01_00073588 predicted 420
6 SASI_Mm01_00073589 predicted 806
7 SASI_Mm01_00073590 predicted 701
8 SASI_Mm01_00073591 predicted 454
9 SASI_Mm01_00073592 predicted 451
10 SASI_Mm01_00073593 predicted 452
11 SASI_Mm01_00073595 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003251
THRSP MISSION shRNA Bacterial Glycerol Stock
thyroid hormone responsive
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003251.2-51s21c1
Sequence:CCGGGAACTGCCTGCTGACCGTCATCTCGAGATGACGGTCAGCAGGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-436s1c1
Sequence:CCGGCAGGAAATGACGGGACAAGTTCTCGAGAACTTGTCCCGTCATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-208s1c1
Sequence:CCGGCTCAAGGCCATCTGTGTGGATCTCGAGATCCACACAGATGGCCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-391s1c1
Sequence:CCGGCTCATGCACCTCACCGAGAAACTCGAGTTTCTCGGTGAGGTGCATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-180s1c1
Sequence:CCGGCCCTGATCTCTACACCTACTTCTCGAGAAGTAGGTGTAGAGATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-282s1c1
Sequence:CCGGCGAAGAGAATGGAACCGCAGACTCGAGTCTGCGGTTCCATTCTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003251
THRSP MISSION shRNA shRNA Plasmid DNA
thyroid hormone responsive
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003251.2-51s21c1
Sequence:CCGGGAACTGCCTGCTGACCGTCATCTCGAGATGACGGTCAGCAGGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-436s1c1
Sequence:CCGGCAGGAAATGACGGGACAAGTTCTCGAGAACTTGTCCCGTCATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-208s1c1
Sequence:CCGGCTCAAGGCCATCTGTGTGGATCTCGAGATCCACACAGATGGCCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-391s1c1
Sequence:CCGGCTCATGCACCTCACCGAGAAACTCGAGTTTCTCGGTGAGGTGCATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-180s1c1
Sequence:CCGGCCCTGATCTCTACACCTACTTCTCGAGAAGTAGGTGTAGAGATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-282s1c1
Sequence:CCGGCGAAGAGAATGGAACCGCAGACTCGAGTCTGCGGTTCCATTCTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003251
THRSP MISSION shRNA Lentiviral Transduction Particles
thyroid hormone responsive
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003251.2-51s21c1
Sequence:CCGGGAACTGCCTGCTGACCGTCATCTCGAGATGACGGTCAGCAGGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-436s1c1
Sequence:CCGGCAGGAAATGACGGGACAAGTTCTCGAGAACTTGTCCCGTCATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-208s1c1
Sequence:CCGGCTCAAGGCCATCTGTGTGGATCTCGAGATCCACACAGATGGCCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-391s1c1
Sequence:CCGGCTCATGCACCTCACCGAGAAACTCGAGTTTCTCGGTGAGGTGCATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-180s1c1
Sequence:CCGGCCCTGATCTCTACACCTACTTCTCGAGAAGTAGGTGTAGAGATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003251.2-282s1c1
Sequence:CCGGCGAAGAGAATGGAACCGCAGACTCGAGTCTGCGGTTCCATTCTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009381
THRSP MISSION shRNA Bacterial Glycerol Stock
thyroid hormone responsive
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009381.2-777s1c1
Sequence:CCGGGCAGTTACTCTTTCATGTATACTCGAGTATACATGAAAGAGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-194s1c1
Sequence:CCGGCTCAAGAGCATCTGTGTAGAACTCGAGTTCTACACAGATGCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-337s1c1
Sequence:CCGGGCTGGACCTAGAAGCCCAGTTCTCGAGAACTGGGCTTCTAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-421s1c1
Sequence:CCGGGACGCGGAAATACCAGGAAATCTCGAGATTTCCTGGTATTTCCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-166s1c1
Sequence:CCGGCCCTGATCTCTATACCTACTTCTCGAGAAGTAGGTATAGAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009381
THRSP MISSION shRNA shRNA Plasmid DNA
thyroid hormone responsive
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009381.2-777s1c1
Sequence:CCGGGCAGTTACTCTTTCATGTATACTCGAGTATACATGAAAGAGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-194s1c1
Sequence:CCGGCTCAAGAGCATCTGTGTAGAACTCGAGTTCTACACAGATGCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-337s1c1
Sequence:CCGGGCTGGACCTAGAAGCCCAGTTCTCGAGAACTGGGCTTCTAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-421s1c1
Sequence:CCGGGACGCGGAAATACCAGGAAATCTCGAGATTTCCTGGTATTTCCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-166s1c1
Sequence:CCGGCCCTGATCTCTATACCTACTTCTCGAGAAGTAGGTATAGAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009381
THRSP MISSION shRNA Lentiviral Transduction Particles
thyroid hormone responsive
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009381.2-777s1c1
Sequence:CCGGGCAGTTACTCTTTCATGTATACTCGAGTATACATGAAAGAGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-194s1c1
Sequence:CCGGCTCAAGAGCATCTGTGTAGAACTCGAGTTCTACACAGATGCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-337s1c1
Sequence:CCGGGCTGGACCTAGAAGCCCAGTTCTCGAGAACTGGGCTTCTAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-421s1c1
Sequence:CCGGGACGCGGAAATACCAGGAAATCTCGAGATTTCCTGGTATTTCCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009381.2-166s1c1
Sequence:CCGGCCCTGATCTCTATACCTACTTCTCGAGAAGTAGGTATAGAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks