EMAIL THIS PAGE TO A FRIEND

THSD1

thrombospondin, type I, domain containing 1

Synonyms: TMTSP UNQ3010
UniProtKB ID: Q9NS62, A2A3J3, B2RCF5, Q6P3U1, Q6UXZ2
Gene ID:
Human(55901) Summary: The protein encoded by this gene contains a type 1 thrombospondin domain, which is found in a number of proteins involved in the complement pathway, as well as in extracellular matrix proteins. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jan 2009]
Mouse(56229) thrombospondin, type I, domain 1
Rat(364630) thrombospondin, type I, domain containing 1
chicken(418884) thrombospondin, type I, domain containing 1
dog(477293) thrombospondin, type I, domain containing 1
Horse(100146573) thrombospondin, type I, domain containing 1
domestic cat(101090828) thrombospondin, type I, domain containing 1
cow(541228) thrombospondin, type I, domain containing 1
sheep(101107367) thrombospondin, type I, domain containing 1
domestic guinea pig(100730301) thrombospondin, type I, domain containing 1
naked mole-rat(101708507) thrombospondin, type I, domain containing 1
Domestic Rabbit(100340607) thrombospondin, type I, domain containing 1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1745 Human THSD1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018676 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018676 Rosetta Predictions human pricing
NM_199263 Rosetta Predictions human pricing
NM_001108878 Rosetta Predictions rat pricing
NM_019576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096015 predicted 1974
2 SASI_Hs01_00096016 predicted 518
3 SASI_Hs01_00096017 predicted 553
4 SASI_Hs01_00096018 predicted 1871
5 SASI_Hs01_00096019 predicted 485
6 SASI_Hs01_00096020 predicted 679
7 SASI_Hs01_00096021 predicted 525
8 SASI_Hs01_00096022 predicted 1879
9 SASI_Hs02_00352191 predicted 2543
10 SASI_Hs01_00096023 predicted 776
11 SASI_Hs01_00096014 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144298 predicted 1815
2 SASI_Hs01_00144299 predicted 522
3 SASI_Hs01_00144300 predicted 548
4 SASI_Hs01_00144301 predicted 1709
5 SASI_Hs01_00144302 predicted 481
6 SASI_Hs01_00144303 predicted 668
7 SASI_Hs01_00144304 predicted 518
8 SASI_Hs01_00144305 predicted 1718
9 SASI_Hs02_00372691 predicted 2373
10 SASI_Hs01_00144306 predicted 773
11 SASI_Hs01_00144297 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242975 predicted 496
2 SASI_Rn02_00242976 predicted 456
3 SASI_Rn02_00242977 predicted 580
4 SASI_Rn02_00242978 predicted 2553
5 SASI_Rn02_00242979 predicted 1919
6 SASI_Rn02_00242980 predicted 1722
7 SASI_Rn02_00242981 predicted 2826
8 SASI_Rn02_00242982 predicted 480
9 SASI_Rn02_00242983 predicted 411
10 SASI_Rn02_00242984 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124802 predicted 295
2 SASI_Mm01_00124803 predicted 2398
3 SASI_Mm01_00124804 predicted 2560
4 SASI_Mm01_00124805 predicted 727
5 SASI_Mm01_00124806 predicted 887
6 SASI_Mm01_00124807 predicted 1671
7 SASI_Mm01_00124808 predicted 459
8 SASI_Mm01_00124809 predicted 331
9 SASI_Mm01_00124810 predicted 326
10 SASI_Mm01_00124811 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019576
THSD1 MISSION shRNA Bacterial Glycerol Stock
thrombospondin, type I, domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-421s1c1
Sequence:CCGGGCCTGTCTTTCACATTGATTTCTCGAGAAATCAATGTGAAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-1511s21c1
Sequence:CCGGACGGGCATCCCATTGACTTACCTCGAGGTAAGTCAATGGGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-97s21c1
Sequence:CCGGTGTCCTCGGAGAAGCCGAATACTCGAGTATTCGGCTTCTCCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-1782s21c1
Sequence:CCGGCAAGCAAGTTCCGAATCAAATCTCGAGATTTGATTCGGAACTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-1782s1c1
Sequence:CCGGCAAGCAAGTTCCGAATCAAATCTCGAGATTTGATTCGGAACTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-1909s1c1
Sequence:CCGGGATCCGAAAGTCACAGATAAGCTCGAGCTTATCTGTGACTTTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-530s1c1
Sequence:CCGGGACATGCTGGTGGATGTTATTCTCGAGAATAACATCCACCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-531s21c1
Sequence:CCGGACATGCTGGTGGATGTTATTTCTCGAGAAATAACATCCACCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019576.1-2598s21c1
Sequence:CCGGCTAGGAAGCAGCAGGGTTCACCTCGAGGTGAACCCTGCTGCTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019576
THSD1 MISSION shRNA shRNA Plasmid DNA
thrombospondin, type I, domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-421s1c1
Sequence:CCGGGCCTGTCTTTCACATTGATTTCTCGAGAAATCAATGTGAAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-1511s21c1
Sequence:CCGGACGGGCATCCCATTGACTTACCTCGAGGTAAGTCAATGGGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-97s21c1
Sequence:CCGGTGTCCTCGGAGAAGCCGAATACTCGAGTATTCGGCTTCTCCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-1782s21c1
Sequence:CCGGCAAGCAAGTTCCGAATCAAATCTCGAGATTTGATTCGGAACTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-1782s1c1
Sequence:CCGGCAAGCAAGTTCCGAATCAAATCTCGAGATTTGATTCGGAACTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-1909s1c1
Sequence:CCGGGATCCGAAAGTCACAGATAAGCTCGAGCTTATCTGTGACTTTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-530s1c1
Sequence:CCGGGACATGCTGGTGGATGTTATTCTCGAGAATAACATCCACCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-531s21c1
Sequence:CCGGACATGCTGGTGGATGTTATTTCTCGAGAAATAACATCCACCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019576.1-2598s21c1
Sequence:CCGGCTAGGAAGCAGCAGGGTTCACCTCGAGGTGAACCCTGCTGCTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019576
THSD1 MISSION shRNA Lentiviral Transduction Particles
thrombospondin, type I, domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-421s1c1
Sequence:CCGGGCCTGTCTTTCACATTGATTTCTCGAGAAATCAATGTGAAAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-1511s21c1
Sequence:CCGGACGGGCATCCCATTGACTTACCTCGAGGTAAGTCAATGGGATGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-97s21c1
Sequence:CCGGTGTCCTCGGAGAAGCCGAATACTCGAGTATTCGGCTTCTCCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-1782s21c1
Sequence:CCGGCAAGCAAGTTCCGAATCAAATCTCGAGATTTGATTCGGAACTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-1782s1c1
Sequence:CCGGCAAGCAAGTTCCGAATCAAATCTCGAGATTTGATTCGGAACTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-1909s1c1
Sequence:CCGGGATCCGAAAGTCACAGATAAGCTCGAGCTTATCTGTGACTTTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019576.1-530s1c1
Sequence:CCGGGACATGCTGGTGGATGTTATTCTCGAGAATAACATCCACCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019576.1-531s21c1
Sequence:CCGGACATGCTGGTGGATGTTATTTCTCGAGAAATAACATCCACCAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019576.1-2598s21c1
Sequence:CCGGCTAGGAAGCAGCAGGGTTCACCTCGAGGTGAACCCTGCTGCTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018676
THSD1 MISSION shRNA Bacterial Glycerol Stock
thrombospondin, type I, domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1942s1c1
Sequence:CCGGGCGCTCCCTTAGATTTGGAAACTCGAGTTTCCAAATCTAAGGGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-2054s1c1
Sequence:CCGGGCTGGATCTAAATGTGACTCACTCGAGTGAGTCACATTTAGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1980s1c1
Sequence:CCGGGCAAACAAGTTCCGGATCAAACTCGAGTTTGATCCGGAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018676.2-2797s1c1
Sequence:CCGGCTGAGAATCAGCCTGAGCTTTCTCGAGAAAGCTCAGGCTGATTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1796s1c1
Sequence:CCGGCCAGAAGATAATCCCACCTCTCTCGAGAGAGGTGGGATTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-523s1c1
Sequence:CCGGCTGGTGACTACTGGTTCACAACTCGAGTTGTGAACCAGTAGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-2693s21c1
Sequence:CCGGTGGAACCCGTGGTCCATTAAACTCGAGTTTAATGGACCACGGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-976s21c1
Sequence:CCGGCCTTCCAAGTGGGCCTATTTACTCGAGTAAATAGGCCCACTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-1534s21c1
Sequence:CCGGAGGAGGAGTGCATGCTAATTCCTCGAGGAATTAGCATGCACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018676
THSD1 MISSION shRNA shRNA Plasmid DNA
thrombospondin, type I, domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1942s1c1
Sequence:CCGGGCGCTCCCTTAGATTTGGAAACTCGAGTTTCCAAATCTAAGGGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-2054s1c1
Sequence:CCGGGCTGGATCTAAATGTGACTCACTCGAGTGAGTCACATTTAGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1980s1c1
Sequence:CCGGGCAAACAAGTTCCGGATCAAACTCGAGTTTGATCCGGAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018676.2-2797s1c1
Sequence:CCGGCTGAGAATCAGCCTGAGCTTTCTCGAGAAAGCTCAGGCTGATTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1796s1c1
Sequence:CCGGCCAGAAGATAATCCCACCTCTCTCGAGAGAGGTGGGATTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-523s1c1
Sequence:CCGGCTGGTGACTACTGGTTCACAACTCGAGTTGTGAACCAGTAGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-2693s21c1
Sequence:CCGGTGGAACCCGTGGTCCATTAAACTCGAGTTTAATGGACCACGGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-976s21c1
Sequence:CCGGCCTTCCAAGTGGGCCTATTTACTCGAGTAAATAGGCCCACTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-1534s21c1
Sequence:CCGGAGGAGGAGTGCATGCTAATTCCTCGAGGAATTAGCATGCACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018676
THSD1 MISSION shRNA Lentiviral Transduction Particles
thrombospondin, type I, domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1942s1c1
Sequence:CCGGGCGCTCCCTTAGATTTGGAAACTCGAGTTTCCAAATCTAAGGGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-2054s1c1
Sequence:CCGGGCTGGATCTAAATGTGACTCACTCGAGTGAGTCACATTTAGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1980s1c1
Sequence:CCGGGCAAACAAGTTCCGGATCAAACTCGAGTTTGATCCGGAACTTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018676.2-2797s1c1
Sequence:CCGGCTGAGAATCAGCCTGAGCTTTCTCGAGAAAGCTCAGGCTGATTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-1796s1c1
Sequence:CCGGCCAGAAGATAATCCCACCTCTCTCGAGAGAGGTGGGATTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018676.2-523s1c1
Sequence:CCGGCTGGTGACTACTGGTTCACAACTCGAGTTGTGAACCAGTAGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-2693s21c1
Sequence:CCGGTGGAACCCGTGGTCCATTAAACTCGAGTTTAATGGACCACGGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-976s21c1
Sequence:CCGGCCTTCCAAGTGGGCCTATTTACTCGAGTAAATAGGCCCACTTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018676.3-1534s21c1
Sequence:CCGGAGGAGGAGTGCATGCTAATTCCTCGAGGAATTAGCATGCACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks