EMAIL THIS PAGE TO A FRIEND

THSD4

thrombospondin, type I, domain containing 4

Synonyms: ADAMTSL-6 ADAMTSL6 FVSY9334 PRO34005
UniProtKB ID: Q6ZMP0, B2RTY3, Q6MZI3, Q6UXZ8, Q9H8E4
Gene ID:
Mouse(207596) thrombospondin, type I, domain containing 4
Rat(315728) thrombospondin, type I, domain containing 4
chicken(415395) thrombospondin, type I, domain containing 4
dog(487628) thrombospondin, type I, domain containing 4
Horse(100063949) thrombospondin, type I, domain containing 4
domestic cat(101094183) thrombospondin, type I, domain containing 4
naked mole-rat(101724355) thrombospondin, type I, domain containing 4
domestic guinea pig(100714712) thrombospondin, type I, domain containing 4
cow(540939) thrombospondin, type I, domain containing 4
sheep(101115035) thrombospondin, type I, domain containing 4
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026845 Anti-THSD4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024817 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093261 MISSION® esiRNA esiRNA human THSD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024817 Rosetta Predictions human pricing
XM_001075236 Rosetta Predictions rat pricing
XM_236312 Rosetta Predictions rat pricing
NM_001040426 Rosetta Predictions mouse pricing
NM_172444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177379 predicted 2034
2 SASI_Hs01_00177380 predicted 1111
3 SASI_Hs01_00177381 predicted 842
4 SASI_Hs01_00177382 predicted 1473
5 SASI_Hs01_00177383 predicted 3045
6 SASI_Hs01_00177384 predicted 743
7 SASI_Hs01_00177386 predicted 2486
8 SASI_Hs01_00177387 predicted 653
9 SASI_Hs02_00357379 predicted 2015
10 SASI_Hs01_00177388 predicted 2951
11 SASI_Hs01_00177385 predicted 2713
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348908 predicted 2329
2 SASI_Rn02_00348909 predicted 1944
3 SASI_Rn02_00348910 predicted 2161
4 SASI_Rn02_00348911 predicted 2888
5 SASI_Rn02_00348912 predicted 2712
6 SASI_Rn02_00348913 predicted 2211
7 SASI_Rn02_00348914 predicted 1216
8 SASI_Rn02_00348915 predicted 1391
9 SASI_Rn02_00348916 predicted 2836
10 SASI_Rn02_00348917 predicted 2814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389964 predicted 1433
2 SASI_Rn02_00389965 predicted 1162
3 SASI_Rn02_00389966 predicted 380
4 SASI_Rn02_00389967 predicted 1075
5 SASI_Rn02_00389968 predicted 945
6 SASI_Rn02_00389969 predicted 1144
7 SASI_Rn02_00389970 predicted 481
8 SASI_Rn02_00389971 predicted 1710
9 SASI_Rn02_00389972 predicted 1387
10 SASI_Rn02_00389973 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132730 predicted 2902
2 SASI_Mm01_00132731 predicted 2998
3 SASI_Mm01_00132732 predicted 3008
4 SASI_Mm01_00132734 predicted 3141
5 SASI_Mm01_00132735 predicted 2721
6 SASI_Mm01_00132736 predicted 2792
7 SASI_Mm01_00132737 predicted 3054
8 SASI_Mm01_00132738 predicted 3666
9 SASI_Mm01_00132739 predicted 2644
10 SASI_Mm02_00290316 predicted 2994
11 SASI_Mm01_00132733 predicted 2673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076791 predicted 1618
2 SASI_Mm01_00076792 predicted 1718
3 SASI_Mm01_00076793 predicted 1728
4 SASI_Mm01_00076795 predicted 1871
5 SASI_Mm01_00076796 predicted 1438
6 SASI_Mm01_00076797 predicted 1511
7 SASI_Mm01_00076798 predicted 1784
8 SASI_Mm01_00076799 predicted 2394
9 SASI_Mm01_00076800 predicted 1375
10 SASI_Mm02_00343952 predicted 1714
11 SASI_Mm01_00076794 predicted 1396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024817
VALIDATED
THSD4 MISSION shRNA Bacterial Glycerol Stock
thrombospondin, type I, domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-2564s1c1
Sequence:CCGGCCCTGAAATCTTTCCGGTCAACTCGAGTTGACCGGAAAGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024817.1-1396s1c1
Sequence:CCGGCCAAATGGTTTAGCACCGAATCTCGAGATTCGGTGCTAAACCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-1477s1c1
Sequence:CCGGCTGATGACATGACTCTAAGTACTCGAGTACTTAGAGTCATGTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-1625s1c1
Sequence:CCGGCTGTGTCTACAACTACTACAACTCGAGTTGTAGTAGTTGTAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-387s1c1
Sequence:CCGGCCTGAGATGTTCACCTCAGAACTCGAGTTCTGAGGTGAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024817
VALIDATED
THSD4 MISSION shRNA shRNA Plasmid DNA
thrombospondin, type I, domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-2564s1c1
Sequence:CCGGCCCTGAAATCTTTCCGGTCAACTCGAGTTGACCGGAAAGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024817.1-1396s1c1
Sequence:CCGGCCAAATGGTTTAGCACCGAATCTCGAGATTCGGTGCTAAACCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-1477s1c1
Sequence:CCGGCTGATGACATGACTCTAAGTACTCGAGTACTTAGAGTCATGTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-1625s1c1
Sequence:CCGGCTGTGTCTACAACTACTACAACTCGAGTTGTAGTAGTTGTAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-387s1c1
Sequence:CCGGCCTGAGATGTTCACCTCAGAACTCGAGTTCTGAGGTGAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024817
VALIDATED
THSD4 MISSION shRNA Lentiviral Transduction Particles
thrombospondin, type I, domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-2564s1c1
Sequence:CCGGCCCTGAAATCTTTCCGGTCAACTCGAGTTGACCGGAAAGATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024817.1-1396s1c1
Sequence:CCGGCCAAATGGTTTAGCACCGAATCTCGAGATTCGGTGCTAAACCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-1477s1c1
Sequence:CCGGCTGATGACATGACTCTAAGTACTCGAGTACTTAGAGTCATGTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-1625s1c1
Sequence:CCGGCTGTGTCTACAACTACTACAACTCGAGTTGTAGTAGTTGTAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024817.1-387s1c1
Sequence:CCGGCCTGAGATGTTCACCTCAGAACTCGAGTTCTGAGGTGAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172444
VALIDATED
THSD4 MISSION shRNA Bacterial Glycerol Stock
thrombospondin, type I, domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-1965s1c1
Sequence:CCGGCCTCTGTGTCTACAACTACTACTCGAGTAGTAGTTGTAGACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172444.1-1738s1c1
Sequence:CCGGGCTAAATGGTTTAGCACAGAACTCGAGTTCTGTGCTAAACCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-3109s1c1
Sequence:CCGGCGCCAGTTAAACCAGCAAGATCTCGAGATCTTGCTGGTTTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-171s1c1
Sequence:CCGGCCTGGGATCTGACAAAGTCTTCTCGAGAAGACTTTGTCAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172444.1-505s1c1
Sequence:CCGGCCCACTAATGAGATCCTGGATCTCGAGATCCAGGATCTCATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172444
VALIDATED
THSD4 MISSION shRNA shRNA Plasmid DNA
thrombospondin, type I, domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-1965s1c1
Sequence:CCGGCCTCTGTGTCTACAACTACTACTCGAGTAGTAGTTGTAGACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172444.1-1738s1c1
Sequence:CCGGGCTAAATGGTTTAGCACAGAACTCGAGTTCTGTGCTAAACCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-3109s1c1
Sequence:CCGGCGCCAGTTAAACCAGCAAGATCTCGAGATCTTGCTGGTTTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-171s1c1
Sequence:CCGGCCTGGGATCTGACAAAGTCTTCTCGAGAAGACTTTGTCAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172444.1-505s1c1
Sequence:CCGGCCCACTAATGAGATCCTGGATCTCGAGATCCAGGATCTCATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172444
VALIDATED
THSD4 MISSION shRNA Lentiviral Transduction Particles
thrombospondin, type I, domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-1965s1c1
Sequence:CCGGCCTCTGTGTCTACAACTACTACTCGAGTAGTAGTTGTAGACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172444.1-1738s1c1
Sequence:CCGGGCTAAATGGTTTAGCACAGAACTCGAGTTCTGTGCTAAACCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-3109s1c1
Sequence:CCGGCGCCAGTTAAACCAGCAAGATCTCGAGATCTTGCTGGTTTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172444.1-171s1c1
Sequence:CCGGCCTGGGATCTGACAAAGTCTTCTCGAGAAGACTTTGTCAGATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172444.1-505s1c1
Sequence:CCGGCCCACTAATGAGATCCTGGATCTCGAGATCCAGGATCTCATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks