EMAIL THIS PAGE TO A FRIEND

THSD7A

thrombospondin, type I, domain containing 7A

UniProtKB ID: Q9UPZ6
Gene ID:
Human(221981) Summary: The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Mouse(330267) thrombospondin, type I, domain containing 7A
Rat(500032) thrombospondin, type I, domain containing 7A
cow(782187) thrombospondin, type I, domain containing 7A
sheep(101116649) thrombospondin, type I, domain containing 7A
domestic guinea pig(100727701) thrombospondin, type I, domain containing 7A
naked mole-rat(101704786) thrombospondin, type I, domain containing 7A
Domestic Rabbit(100347319) thrombospondin, type I, domain containing 7A
Zebrafish(557991) thrombospondin, type I, domain containing 7A
chicken(420585) thrombospondin, type I, domain containing 7A
dog(100686606) thrombospondin, type I, domain containing 7A
domestic cat(101100458) thrombospondin, type I, domain containing 7A
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015204 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015204 Rosetta Predictions human pricing
XM_371877 Rosetta Predictions human pricing
XM_928187 Rosetta Predictions human pricing
XM_932697 Rosetta Predictions human pricing
XM_001055908 Rosetta Predictions rat pricing
XM_575387 Rosetta Predictions rat pricing
XM_287555 Rosetta Predictions mouse pricing
XM_983072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347292 predicted 4548
2 SASI_Hs02_00347293 predicted 1423
3 SASI_Hs02_00347294 predicted 2379
4 SASI_Hs02_00347295 predicted 3415
5 SASI_Hs02_00347296 predicted 3286
6 SASI_Hs02_00347297 predicted 1080
7 SASI_Hs02_00347298 predicted 5054
8 SASI_Hs02_00347299 predicted 4570
9 SASI_Hs02_00347300 predicted 3828
10 SASI_Hs02_00347301 predicted 4419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262329 predicted 340
2 SASI_Hs01_00262330 predicted 2877
3 SASI_Hs01_00262331 predicted 4328
4 SASI_Hs01_00262332 predicted 2153
5 SASI_Hs01_00262333 predicted 3197
6 SASI_Hs01_00262334 predicted 370
7 SASI_Hs01_00262335 predicted 4827
8 SASI_Hs01_00262336 predicted 4351
9 SASI_Hs01_00262337 predicted 535
10 SASI_Hs01_00262338 predicted 4198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273394 predicted 3107
2 SASI_Hs01_00273395 predicted 4549
3 SASI_Hs01_00273396 predicted 2380
4 SASI_Hs01_00273397 predicted 3421
5 SASI_Hs01_00273398 predicted 603
6 SASI_Hs01_00273399 predicted 5053
7 SASI_Hs01_00273400 predicted 4570
8 SASI_Hs01_00273401 predicted 760
9 SASI_Hs01_00273402 predicted 4416
10 SASI_Hs01_00273403 predicted 2216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288990 predicted 952
2 SASI_Hs01_00288991 predicted 822
3 SASI_Hs01_00288992 predicted 817
4 SASI_Hs01_00288993 predicted 895
5 SASI_Hs01_00288994 predicted 906
6 SASI_Hs01_00288995 predicted 302
7 SASI_Hs01_00288996 predicted 944
8 SASI_Hs01_00288997 predicted 936
9 SASI_Hs01_00288998 predicted 339
10 SASI_Hs01_00288999 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281358 predicted 5069
2 SASI_Rn02_00281359 predicted 5284
3 SASI_Rn02_00281360 predicted 4133
4 SASI_Rn02_00281361 predicted 2505
5 SASI_Rn02_00281362 predicted 2977
6 SASI_Rn02_00281363 predicted 5077
7 SASI_Rn02_00281364 predicted 5386
8 SASI_Rn02_00281365 predicted 1232
9 SASI_Rn02_00281366 predicted 5047
10 SASI_Rn02_00281367 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403611 predicted 4130
2 SASI_Rn02_00403612 predicted 2511
3 SASI_Rn02_00403613 predicted 2971
4 SASI_Rn02_00403614 predicted 1225
5 SASI_Rn02_00403615 predicted 1966
6 SASI_Rn02_00403616 predicted 2559
7 SASI_Rn02_00403617 predicted 2463
8 SASI_Rn02_00403618 predicted 1658
9 SASI_Rn02_00403619 predicted 794
10 SASI_Rn02_00403620 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_287555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226997 predicted 2397
2 SASI_Mm02_00425721 predicted 2224
3 SASI_Mm01_00226999 predicted 4292
4 SASI_Mm01_00227000 predicted 5001
5 SASI_Mm02_00425722 predicted 2179
6 SASI_Mm01_00227002 predicted 4792
7 SASI_Mm01_00227004 predicted 4318
8 SASI_Mm02_00425723 predicted 584
9 SASI_Mm01_00227005 predicted 4748
10 SASI_Mm01_00227006 predicted 3813
11 SASI_Mm01_00226998 predicted 2904
12 SASI_Mm01_00227001 predicted 2426
13 SASI_Mm01_00227003 predicted 1774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448018 predicted 2400
2 SASI_Mm02_00448019 predicted 2221
3 SASI_Mm02_00448020 predicted 4294
4 SASI_Mm02_00448021 predicted 5003
5 SASI_Mm02_00448022 predicted 2175
6 SASI_Mm02_00448023 predicted 2293
7 SASI_Mm02_00448024 predicted 4791
8 SASI_Mm02_00448025 predicted 3584
9 SASI_Mm02_00448026 predicted 4320
10 SASI_Mm02_00448027 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015204
VALIDATED
THSD7A MISSION shRNA Bacterial Glycerol Stock
thrombospondin, type I, domain containing 7A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-4731s21c1
Sequence:CCGGTCAAAGGTCAGATGGTATAAACTCGAGTTTATACCATCTGACCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-6248s21c1
Sequence:CCGGTTGACAACATGGCGGTAATTTCTCGAGAAATTACCGCCATGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-1108s21c1
Sequence:CCGGGACCGCAGCAAAGGAGTAAAGCTCGAGCTTTACTCCTTTGCTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-4582s21c1
Sequence:CCGGAGATCCAGACCGGTGATTATACTCGAGTATAATCACCGGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-5213s21c1
Sequence:CCGGATGCCGACATGTAACATATAACTCGAGTTATATGTTACATGTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015204
VALIDATED
THSD7A MISSION shRNA shRNA Plasmid DNA
thrombospondin, type I, domain containing 7A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-4731s21c1
Sequence:CCGGTCAAAGGTCAGATGGTATAAACTCGAGTTTATACCATCTGACCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-6248s21c1
Sequence:CCGGTTGACAACATGGCGGTAATTTCTCGAGAAATTACCGCCATGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-1108s21c1
Sequence:CCGGGACCGCAGCAAAGGAGTAAAGCTCGAGCTTTACTCCTTTGCTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-4582s21c1
Sequence:CCGGAGATCCAGACCGGTGATTATACTCGAGTATAATCACCGGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-5213s21c1
Sequence:CCGGATGCCGACATGTAACATATAACTCGAGTTATATGTTACATGTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015204
VALIDATED
THSD7A MISSION shRNA Lentiviral Transduction Particles
thrombospondin, type I, domain containing 7A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-4731s21c1
Sequence:CCGGTCAAAGGTCAGATGGTATAAACTCGAGTTTATACCATCTGACCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-6248s21c1
Sequence:CCGGTTGACAACATGGCGGTAATTTCTCGAGAAATTACCGCCATGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-1108s21c1
Sequence:CCGGGACCGCAGCAAAGGAGTAAAGCTCGAGCTTTACTCCTTTGCTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-4582s21c1
Sequence:CCGGAGATCCAGACCGGTGATTATACTCGAGTATAATCACCGGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015204.1-5213s21c1
Sequence:CCGGATGCCGACATGTAACATATAACTCGAGTTATATGTTACATGTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks