EMAIL THIS PAGE TO A FRIEND

THSD7B

thrombospondin, type I, domain containing 7B

UniProtKB ID: Q9C0I4
Gene ID:
Mouse(210417) thrombospondin, type I, domain containing 7B
Rat(289007) thrombospondin, type I, domain containing 7B
Zebrafish(100333732) thrombospondin, type I, domain containing 7B
chicken(424297) thrombospondin, type I, domain containing 7B
domestic cat(101093954) thrombospondin, type I, domain containing 7B
Horse(100051048) thrombospondin, type I, domain containing 7B
dog(100684750) thrombospondin, type I, domain containing 7B
Domestic Rabbit(100346704) thrombospondin, type I, domain containing 7B
naked mole-rat(101701883) thrombospondin, type I, domain containing 7B
domestic guinea pig(100730864) thrombospondin, type I, domain containing 7B
cow(100336727) thrombospondin, type I, domain containing 7B
sheep(101115946) thrombospondin, type I, domain containing 7B
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080427 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038001 MISSION® esiRNA esiRNA human THSD7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080427 Rosetta Predictions human pricing
XM_046570 Rosetta Predictions human pricing
XM_222597 Rosetta Predictions rat pricing
NM_172485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314746 predicted 3284
2 SASI_Hs02_00314747 predicted 615
3 SASI_Hs02_00314748 predicted 2889
4 SASI_Hs02_00314749 predicted 3088
5 SASI_Hs02_00314750 predicted 1515
6 SASI_Hs02_00314751 predicted 3705
7 SASI_Hs02_00314752 predicted 505
8 SASI_Hs02_00314753 predicted 1487
9 SASI_Hs02_00314754 predicted 4264
10 SASI_Hs02_00314755 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_046570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296020 predicted 3336
2 SASI_Hs01_00296021 predicted 662
3 SASI_Hs01_00296022 predicted 3424
4 SASI_Hs01_00296023 predicted 3131
5 SASI_Hs01_00296024 predicted 1571
6 SASI_Hs01_00296025 predicted 3761
7 SASI_Hs01_00296026 predicted 558
8 SASI_Hs01_00296027 predicted 1541
9 SASI_Hs01_00296028 predicted 4307
10 SASI_Hs01_00296029 predicted 4076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380805 predicted 3020
2 SASI_Rn02_00380806 predicted 2453
3 SASI_Rn02_00380807 predicted 2709
4 SASI_Rn02_00380808 predicted 3972
5 SASI_Rn02_00380809 predicted 4572
6 SASI_Rn02_00380810 predicted 1126
7 SASI_Rn02_00380811 predicted 2043
8 SASI_Rn02_00380812 predicted 3343
9 SASI_Rn02_00380813 predicted 3326
10 SASI_Rn02_00380814 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092822 predicted 2929
2 SASI_Mm02_00344052 predicted 2279
3 SASI_Mm01_00092823 predicted 2072
4 SASI_Mm02_00344053 predicted 3293
5 SASI_Mm01_00092824 predicted 2032
6 SASI_Mm01_00092825 predicted 2084
7 SASI_Mm01_00092826 predicted 789
8 SASI_Mm01_00092827 predicted 5002
9 SASI_Mm01_00092828 predicted 3361
10 SASI_Mm01_00092829 predicted 5075
11 SASI_Mm01_00092830 predicted 871
12 SASI_Mm01_00092831 predicted 4581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172485
THSD7B MISSION shRNA Bacterial Glycerol Stock
thrombospondin, type I, domain containing 7B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172485.3-5472s21c1
Sequence:CCGGCTTGATCCTCAGCCGCATATTCTCGAGAATATGCGGCTGAGGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172485.3-5260s21c1
Sequence:CCGGCCTTGGGCAGAATACGAATATCTCGAGATATTCGTATTCTGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172485.3-3091s21c1
Sequence:CCGGATGTCCCTGTGATACGTTTATCTCGAGATAAACGTATCACAGGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172485.3-1425s21c1
Sequence:CCGGGCCGGAACGTGAAGCATATTGCTCGAGCAATATGCTTCACGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-947s1c1
Sequence:CCGGCGGAAGAAATATCCAGGATTTCTCGAGAAATCCTGGATATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-2420s1c1
Sequence:CCGGCCAGCCAGGAAATACTACAATCTCGAGATTGTAGTATTTCCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172485.2-5665s1c1
Sequence:CCGGGCAGAGTGTTAGCAAGGAAATCTCGAGATTTCCTTGCTAACACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-1615s1c1
Sequence:CCGGGCATAGTATCTTCCTGGTCAACTCGAGTTGACCAGGAAGATACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-3974s1c1
Sequence:CCGGCCGGACTCGATTTATCATTATCTCGAGATAATGATAAATCGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172485
THSD7B MISSION shRNA shRNA Plasmid DNA
thrombospondin, type I, domain containing 7B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172485.3-5472s21c1
Sequence:CCGGCTTGATCCTCAGCCGCATATTCTCGAGAATATGCGGCTGAGGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172485.3-5260s21c1
Sequence:CCGGCCTTGGGCAGAATACGAATATCTCGAGATATTCGTATTCTGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172485.3-3091s21c1
Sequence:CCGGATGTCCCTGTGATACGTTTATCTCGAGATAAACGTATCACAGGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172485.3-1425s21c1
Sequence:CCGGGCCGGAACGTGAAGCATATTGCTCGAGCAATATGCTTCACGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-947s1c1
Sequence:CCGGCGGAAGAAATATCCAGGATTTCTCGAGAAATCCTGGATATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-2420s1c1
Sequence:CCGGCCAGCCAGGAAATACTACAATCTCGAGATTGTAGTATTTCCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172485.2-5665s1c1
Sequence:CCGGGCAGAGTGTTAGCAAGGAAATCTCGAGATTTCCTTGCTAACACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-1615s1c1
Sequence:CCGGGCATAGTATCTTCCTGGTCAACTCGAGTTGACCAGGAAGATACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-3974s1c1
Sequence:CCGGCCGGACTCGATTTATCATTATCTCGAGATAATGATAAATCGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172485
THSD7B MISSION shRNA Lentiviral Transduction Particles
thrombospondin, type I, domain containing 7B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172485.3-5472s21c1
Sequence:CCGGCTTGATCCTCAGCCGCATATTCTCGAGAATATGCGGCTGAGGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172485.3-5260s21c1
Sequence:CCGGCCTTGGGCAGAATACGAATATCTCGAGATATTCGTATTCTGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172485.3-3091s21c1
Sequence:CCGGATGTCCCTGTGATACGTTTATCTCGAGATAAACGTATCACAGGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172485.3-1425s21c1
Sequence:CCGGGCCGGAACGTGAAGCATATTGCTCGAGCAATATGCTTCACGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-947s1c1
Sequence:CCGGCGGAAGAAATATCCAGGATTTCTCGAGAAATCCTGGATATTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-2420s1c1
Sequence:CCGGCCAGCCAGGAAATACTACAATCTCGAGATTGTAGTATTTCCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172485.2-5665s1c1
Sequence:CCGGGCAGAGTGTTAGCAAGGAAATCTCGAGATTTCCTTGCTAACACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-1615s1c1
Sequence:CCGGGCATAGTATCTTCCTGGTCAACTCGAGTTGACCAGGAAGATACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172485.2-3974s1c1
Sequence:CCGGCCGGACTCGATTTATCATTATCTCGAGATAATGATAAATCGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080427
THSD7B MISSION shRNA Bacterial Glycerol Stock
thrombospondin, type I, domain containing 7B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080427.1-4889s21c1
Sequence:CCGGACATGGAGTCAAGGATTATTACTCGAGTAATAATCCTTGACTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-2238s21c1
Sequence:CCGGGGAATGCCCAGATACCTTATACTCGAGTATAAGGTATCTGGGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-4557s21c1
Sequence:CCGGTGATCCAGATGGCCGAGTAAACTCGAGTTTACTCGGCCATCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-4262s21c1
Sequence:CCGGAGCGTTCAGATGGCGTTAATGCTCGAGCATTAACGCCATCTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-3718s21c1
Sequence:CCGGATGAGCCGGACTCGATTTATCCTCGAGGATAAATCGAGTCCGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080427
THSD7B MISSION shRNA shRNA Plasmid DNA
thrombospondin, type I, domain containing 7B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080427.1-4889s21c1
Sequence:CCGGACATGGAGTCAAGGATTATTACTCGAGTAATAATCCTTGACTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-2238s21c1
Sequence:CCGGGGAATGCCCAGATACCTTATACTCGAGTATAAGGTATCTGGGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-4557s21c1
Sequence:CCGGTGATCCAGATGGCCGAGTAAACTCGAGTTTACTCGGCCATCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-4262s21c1
Sequence:CCGGAGCGTTCAGATGGCGTTAATGCTCGAGCATTAACGCCATCTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-3718s21c1
Sequence:CCGGATGAGCCGGACTCGATTTATCCTCGAGGATAAATCGAGTCCGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080427
THSD7B MISSION shRNA Lentiviral Transduction Particles
thrombospondin, type I, domain containing 7B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080427.1-4889s21c1
Sequence:CCGGACATGGAGTCAAGGATTATTACTCGAGTAATAATCCTTGACTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-2238s21c1
Sequence:CCGGGGAATGCCCAGATACCTTATACTCGAGTATAAGGTATCTGGGCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-4557s21c1
Sequence:CCGGTGATCCAGATGGCCGAGTAAACTCGAGTTTACTCGGCCATCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-4262s21c1
Sequence:CCGGAGCGTTCAGATGGCGTTAATGCTCGAGCATTAACGCCATCTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080427.1-3718s21c1
Sequence:CCGGATGAGCCGGACTCGATTTATCCTCGAGGATAAATCGAGTCCGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks