EMAIL THIS PAGE TO A FRIEND

THTPA

thiamine triphosphatase

Synonyms: THTP THTPASE
UniProtKB ID: Q9BU02, D3DS50, G3V4J3
Gene ID:
Human(79178) Summary: This gene encodes an enzyme which catalyzes the biosynthesis of thiamine disphophate (vitamin B1) by hydrolysis of thiamine triphosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Mouse(105663) thiamine triphosphatase
Rat(305889) thiamine triphosphatase
Zebrafish(100048920) thiamine triphosphatase
dog(490614) thiamine triphosphatase
domestic cat(101097247) thiamine triphosphatase
cow(282090) thiamine triphosphatase
sheep(101119565) thiamine triphosphatase
Goat(100860962) thiamine triphosphatase
domestic guinea pig(100725495) thiamine triphosphatase
naked mole-rat(101709464) thiamine triphosphatase
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001126339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126339 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126339 Rosetta Predictions human pricing
NM_024328 Rosetta Predictions human pricing
NR_023314 Rosetta Predictions human pricing
NM_001007682 Rosetta Predictions rat pricing
NM_153083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328477 predicted 754
2 SASI_Hs02_00328478 predicted 787
3 SASI_Hs02_00328479 predicted 1423
4 SASI_Hs02_00328480 predicted 1375
5 SASI_Hs02_00328481 predicted 1516
6 SASI_Hs02_00328482 predicted 939
7 SASI_Hs02_00328483 predicted 867
8 SASI_Hs02_00328484 predicted 980
9 SASI_Hs02_00328485 predicted 1503
10 SASI_Hs02_00328486 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356677 predicted 1159
2 SASI_Hs02_00356678 predicted 1186
3 SASI_Hs02_00356679 predicted 1821
4 SASI_Hs02_00356680 predicted 1779
5 SASI_Hs02_00356681 predicted 1915
6 SASI_Hs02_00356682 predicted 1344
7 SASI_Hs01_00063689 predicted 1262
8 SASI_Hs01_00063691 predicted 1375
9 SASI_Hs01_00063692 predicted 1903
10 SASI_Hs01_00063694 predicted 1682
11 SASI_Hs01_00063686 predicted 913
12 SASI_Hs01_00063687 predicted 1794
13 SASI_Hs01_00063688 predicted 1696
14 SASI_Hs01_00063690 predicted 1893
15 SASI_Hs01_00063693 predicted 982
16 SASI_Hs01_00063695 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381622 predicted 863
2 SASI_Hs02_00381623 predicted 953
3 SASI_Hs02_00381624 predicted 272
4 SASI_Hs02_00381625 predicted 861
5 SASI_Hs02_00381626 predicted 959
6 SASI_Hs02_00381627 predicted 415
7 SASI_Hs02_00381628 predicted 944
8 SASI_Hs02_00381629 predicted 816
9 SASI_Hs02_00381630 predicted 720
10 SASI_Hs02_00381631 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054612 predicted 465
2 SASI_Rn01_00054613 predicted 1294
3 SASI_Rn01_00054614 predicted 494
4 SASI_Rn01_00054616 predicted 491
5 SASI_Rn01_00054617 predicted 1255
6 SASI_Rn01_00054618 predicted 791
7 SASI_Rn01_00054619 predicted 930
8 SASI_Rn01_00054620 predicted 1270
9 SASI_Rn01_00054621 predicted 1119
10 SASI_Rn02_00198826 predicted 1270
11 SASI_Rn01_00054615 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155677 predicted 796
2 SASI_Mm01_00155679 predicted 736
3 SASI_Mm01_00155680 predicted 757
4 SASI_Mm01_00155681 predicted 882
5 SASI_Mm01_00155682 predicted 1288
6 SASI_Mm01_00155683 predicted 1073
7 SASI_Mm01_00155684 predicted 754
8 SASI_Mm01_00155685 predicted 731
9 SASI_Mm02_00342918 predicted 1079
10 SASI_Mm01_00155686 predicted 769
11 SASI_Mm01_00155678 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153083
VALIDATED
THTPA MISSION shRNA Bacterial Glycerol Stock
thiamine triphosphatase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-1077s1c1
Sequence:CCGGGCCTCAGCTCACAATAGACTTCTCGAGAAGTCTATTGTGAGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153083.2-1234s1c1
Sequence:CCGGGCCAAGCTCATGGTATACCTACTCGAGTAGGTATACCATGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153083.2-847s1c1
Sequence:CCGGGAGCTCAAATGTCCTGGAGTACTCGAGTACTCCAGGACATTTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-792s1c1
Sequence:CCGGGTTAAGCCTTATGCTGTCTGACTCGAGTCAGACAGCATAAGGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-1558s1c1
Sequence:CCGGCCATTGATTTCCGCTCGTGTTCTCGAGAACACGAGCGGAAATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153083
VALIDATED
THTPA MISSION shRNA shRNA Plasmid DNA
thiamine triphosphatase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-1077s1c1
Sequence:CCGGGCCTCAGCTCACAATAGACTTCTCGAGAAGTCTATTGTGAGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153083.2-1234s1c1
Sequence:CCGGGCCAAGCTCATGGTATACCTACTCGAGTAGGTATACCATGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153083.2-847s1c1
Sequence:CCGGGAGCTCAAATGTCCTGGAGTACTCGAGTACTCCAGGACATTTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-792s1c1
Sequence:CCGGGTTAAGCCTTATGCTGTCTGACTCGAGTCAGACAGCATAAGGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-1558s1c1
Sequence:CCGGCCATTGATTTCCGCTCGTGTTCTCGAGAACACGAGCGGAAATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153083
VALIDATED
THTPA MISSION shRNA Lentiviral Transduction Particles
thiamine triphosphatase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-1077s1c1
Sequence:CCGGGCCTCAGCTCACAATAGACTTCTCGAGAAGTCTATTGTGAGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153083.2-1234s1c1
Sequence:CCGGGCCAAGCTCATGGTATACCTACTCGAGTAGGTATACCATGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153083.2-847s1c1
Sequence:CCGGGAGCTCAAATGTCCTGGAGTACTCGAGTACTCCAGGACATTTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-792s1c1
Sequence:CCGGGTTAAGCCTTATGCTGTCTGACTCGAGTCAGACAGCATAAGGCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153083.2-1558s1c1
Sequence:CCGGCCATTGATTTCCGCTCGTGTTCTCGAGAACACGAGCGGAAATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370754
VALIDATED
THTPA MISSION shRNA Bacterial Glycerol Stock
thiamine triphosphatase
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000051079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-599s1c1
Sequence:CCGGGACTTGGATACAGCCGACTTTCTCGAGAAAGTCGGCTGTATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-508s1c1
Sequence:CCGGGCTGCAGGAAGTAGCTAGTTTCTCGAGAAACTAGCTACTTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-266s1c1
Sequence:CCGGACCTTCCGAGACACCTACTATCTCGAGATAGTAGGTGTCTCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370754.2-419s1c1
Sequence:CCGGGAACCTACAATTGTGGCCCAACTCGAGTTGGGCCACAATTGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370754
VALIDATED
THTPA MISSION shRNA shRNA Plasmid DNA
thiamine triphosphatase
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000051079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-599s1c1
Sequence:CCGGGACTTGGATACAGCCGACTTTCTCGAGAAAGTCGGCTGTATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-508s1c1
Sequence:CCGGGCTGCAGGAAGTAGCTAGTTTCTCGAGAAACTAGCTACTTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-266s1c1
Sequence:CCGGACCTTCCGAGACACCTACTATCTCGAGATAGTAGGTGTCTCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370754.2-419s1c1
Sequence:CCGGGAACCTACAATTGTGGCCCAACTCGAGTTGGGCCACAATTGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370754
VALIDATED
THTPA MISSION shRNA Lentiviral Transduction Particles
thiamine triphosphatase
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000051079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-599s1c1
Sequence:CCGGGACTTGGATACAGCCGACTTTCTCGAGAAAGTCGGCTGTATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-508s1c1
Sequence:CCGGGCTGCAGGAAGTAGCTAGTTTCTCGAGAAACTAGCTACTTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_370754.2-266s1c1
Sequence:CCGGACCTTCCGAGACACCTACTATCTCGAGATAGTAGGTGTCTCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370754.2-419s1c1
Sequence:CCGGGAACCTACAATTGTGGCCCAACTCGAGTTGGGCCACAATTGTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126339
THTPA MISSION shRNA Bacterial Glycerol Stock
thiamine triphosphatase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-546s21c1
Sequence:CCGGATAGTGGATGGGAGCTCAAATCTCGAGATTTGAGCTCCCATCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-969s21c1
Sequence:CCGGGTTTCCGGCCTCAAGACTATCCTCGAGGATAGTCTTGAGGCCGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-763s21c1
Sequence:CCGGGCTCTTGGGAGCTGATGAAGACTCGAGTCTTCATCAGCTCCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126339.1-1336s21c1
Sequence:CCGGTTAGCCGTGATCAGTAGTTAACTCGAGTTAACTACTGATCACGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-871s21c1
Sequence:CCGGAGTACCAACTGCCCTAGAGAACTCGAGTTCTCTAGGGCAGTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126339
THTPA MISSION shRNA shRNA Plasmid DNA
thiamine triphosphatase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-546s21c1
Sequence:CCGGATAGTGGATGGGAGCTCAAATCTCGAGATTTGAGCTCCCATCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-969s21c1
Sequence:CCGGGTTTCCGGCCTCAAGACTATCCTCGAGGATAGTCTTGAGGCCGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-763s21c1
Sequence:CCGGGCTCTTGGGAGCTGATGAAGACTCGAGTCTTCATCAGCTCCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126339.1-1336s21c1
Sequence:CCGGTTAGCCGTGATCAGTAGTTAACTCGAGTTAACTACTGATCACGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-871s21c1
Sequence:CCGGAGTACCAACTGCCCTAGAGAACTCGAGTTCTCTAGGGCAGTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126339
THTPA MISSION shRNA Lentiviral Transduction Particles
thiamine triphosphatase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-546s21c1
Sequence:CCGGATAGTGGATGGGAGCTCAAATCTCGAGATTTGAGCTCCCATCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-969s21c1
Sequence:CCGGGTTTCCGGCCTCAAGACTATCCTCGAGGATAGTCTTGAGGCCGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-763s21c1
Sequence:CCGGGCTCTTGGGAGCTGATGAAGACTCGAGTCTTCATCAGCTCCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126339.1-1336s21c1
Sequence:CCGGTTAGCCGTGATCAGTAGTTAACTCGAGTTAACTACTGATCACGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126339.1-871s21c1
Sequence:CCGGAGTACCAACTGCCCTAGAGAACTCGAGTTCTCTAGGGCAGTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks