EMAIL THIS PAGE TO A FRIEND

THUMPD1

THUMP domain containing 1

UniProtKB ID: Q9NXG2, Q9BWC3
Gene ID:
Mouse(233802) THUMP domain containing 1
Rat(309041) THUMP domain containing 1
naked mole-rat(101697765) THUMP domain containing 1
domestic guinea pig(100716302) THUMP domain containing 1
cow(524854) THUMP domain containing 1
sheep(101121057) THUMP domain containing 1
chicken(426998) THUMP domain containing 1
dog(489984) THUMP domain containing 1
domestic cat(101082967) THUMP domain containing 1
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017736 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017736 Rosetta Predictions human pricing
NM_001009688 Rosetta Predictions rat pricing
XM_001079074 Rosetta Predictions rat pricing
NM_145585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104528 predicted 551
2 SASI_Hs01_00104529 predicted 270
3 SASI_Hs01_00104530 predicted 540
4 SASI_Hs01_00104531 predicted 719
5 SASI_Hs01_00104532 predicted 978
6 SASI_Hs01_00104533 predicted 840
7 SASI_Hs01_00104534 predicted 745
8 SASI_Hs01_00104535 predicted 545
9 SASI_Hs01_00104536 predicted 453
10 SASI_Hs02_00350525 predicted 458
11 SASI_Hs01_00104527 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054211 predicted 483
2 SASI_Rn01_00054212 predicted 437
3 SASI_Rn01_00054213 predicted 583
4 SASI_Rn01_00054214 predicted 708
5 SASI_Rn01_00054215 predicted 422
6 SASI_Rn01_00054216 predicted 620
7 SASI_Rn01_00054217 predicted 623
8 SASI_Rn01_00054218 predicted 1106
9 SASI_Rn01_00054220 predicted 1107
10 SASI_Rn02_00199748 predicted 418
11 SASI_Rn01_00054219 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363101 predicted 584
2 SASI_Rn02_00363102 predicted 262
3 SASI_Rn02_00363103 predicted 649
4 SASI_Rn02_00363104 predicted 980
5 SASI_Rn02_00363105 predicted 887
6 SASI_Rn02_00363106 predicted 757
7 SASI_Rn02_00363107 predicted 502
8 SASI_Rn02_00363108 predicted 472
9 SASI_Rn02_00363109 predicted 516
10 SASI_Rn02_00363110 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201737 predicted 390
2 SASI_Mm01_00201738 predicted 713
3 SASI_Mm01_00201739 predicted 628
4 SASI_Mm01_00201740 predicted 428
5 SASI_Mm02_00341122 predicted 646
6 SASI_Mm01_00201741 predicted 484
7 SASI_Mm01_00201742 predicted 991
8 SASI_Mm01_00201743 predicted 430
9 SASI_Mm01_00201744 predicted 621
10 SASI_Mm01_00201745 predicted 638
11 SASI_Mm01_00201746 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145585
VALIDATED
THUMPD1 MISSION shRNA Bacterial Glycerol Stock
THUMP domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145585.1-627s21c1
Sequence:CCGGATCTCGAAACAATAGCCATATCTCGAGATATGGCTATTGTTTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-1009s21c1
Sequence:CCGGGACGCTAAACCTGAACCTGAACTCGAGTTCAGGTTCAGGTTTAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-1097s21c1
Sequence:CCGGGTCTCAGCTAGGGTTCCATATCTCGAGATATGGAACCCTAGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-339s21c1
Sequence:CCGGCATTAAGGCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGCCTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-382s21c1
Sequence:CCGGGTGGAGAGTGGAGCGAATAATCTCGAGATTATTCGCTCCACTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-1009s1c1
Sequence:CCGGGACGCTAAACCTGAACCTGAACTCGAGTTCAGGTTCAGGTTTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145585.1-1623s1c1
Sequence:CCGGGCCACATATCCTAGTACCAAACTCGAGTTTGGTACTAGGATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-489s1c1
Sequence:CCGGGACAAGGGTTATTCTACGAATCTCGAGATTCGTAGAATAACCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-339s1c1
Sequence:CCGGCATTAAGGCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145585
VALIDATED
THUMPD1 MISSION shRNA shRNA Plasmid DNA
THUMP domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145585.1-627s21c1
Sequence:CCGGATCTCGAAACAATAGCCATATCTCGAGATATGGCTATTGTTTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-1009s21c1
Sequence:CCGGGACGCTAAACCTGAACCTGAACTCGAGTTCAGGTTCAGGTTTAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-1097s21c1
Sequence:CCGGGTCTCAGCTAGGGTTCCATATCTCGAGATATGGAACCCTAGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-339s21c1
Sequence:CCGGCATTAAGGCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGCCTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-382s21c1
Sequence:CCGGGTGGAGAGTGGAGCGAATAATCTCGAGATTATTCGCTCCACTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-1009s1c1
Sequence:CCGGGACGCTAAACCTGAACCTGAACTCGAGTTCAGGTTCAGGTTTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145585.1-1623s1c1
Sequence:CCGGGCCACATATCCTAGTACCAAACTCGAGTTTGGTACTAGGATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-489s1c1
Sequence:CCGGGACAAGGGTTATTCTACGAATCTCGAGATTCGTAGAATAACCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-339s1c1
Sequence:CCGGCATTAAGGCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145585
VALIDATED
THUMPD1 MISSION shRNA Lentiviral Transduction Particles
THUMP domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145585.1-627s21c1
Sequence:CCGGATCTCGAAACAATAGCCATATCTCGAGATATGGCTATTGTTTCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-1009s21c1
Sequence:CCGGGACGCTAAACCTGAACCTGAACTCGAGTTCAGGTTCAGGTTTAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-1097s21c1
Sequence:CCGGGTCTCAGCTAGGGTTCCATATCTCGAGATATGGAACCCTAGCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-339s21c1
Sequence:CCGGCATTAAGGCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGCCTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145585.1-382s21c1
Sequence:CCGGGTGGAGAGTGGAGCGAATAATCTCGAGATTATTCGCTCCACTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-1009s1c1
Sequence:CCGGGACGCTAAACCTGAACCTGAACTCGAGTTCAGGTTCAGGTTTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145585.1-1623s1c1
Sequence:CCGGGCCACATATCCTAGTACCAAACTCGAGTTTGGTACTAGGATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-489s1c1
Sequence:CCGGGACAAGGGTTATTCTACGAATCTCGAGATTCGTAGAATAACCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145585.1-339s1c1
Sequence:CCGGCATTAAGGCTTCTACAGAGAACTCGAGTTCTCTGTAGAAGCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017736
THUMPD1 MISSION shRNA Bacterial Glycerol Stock
THUMP domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017736.3-516s21c1
Sequence:CCGGCGTTGTCTTCATCAGGACACTCTCGAGAGTGTCCTGATGAAGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017736.3-862s21c1
Sequence:CCGGGAAATCATCAAAGCTGTCTGTCTCGAGACAGACAGCTTTGATGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-435s1c1
Sequence:CCGGCGTTGTCTTCATCAGGACACTCTCGAGAGTGTCCTGATGAAGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-1084s1c1
Sequence:CCGGGAAGGATCCAAGTCAAATGAACTCGAGTTCATTTGACTTGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-480s1c1
Sequence:CCGGGCATCATATTCTCCAGGATATCTCGAGATATCCTGGAGAATATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-346s1c1
Sequence:CCGGGCTGCCTTGAAGAAAGAAGTTCTCGAGAACTTCTTTCTTCAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017736.2-372s1c1
Sequence:CCGGCATTAAGGCATCTACAGAGATCTCGAGATCTCTGTAGATGCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-781s1c1
Sequence:CCGGGAAATCATCAAAGCTGTCTGTCTCGAGACAGACAGCTTTGATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017736
THUMPD1 MISSION shRNA shRNA Plasmid DNA
THUMP domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017736.3-516s21c1
Sequence:CCGGCGTTGTCTTCATCAGGACACTCTCGAGAGTGTCCTGATGAAGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017736.3-862s21c1
Sequence:CCGGGAAATCATCAAAGCTGTCTGTCTCGAGACAGACAGCTTTGATGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-435s1c1
Sequence:CCGGCGTTGTCTTCATCAGGACACTCTCGAGAGTGTCCTGATGAAGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-1084s1c1
Sequence:CCGGGAAGGATCCAAGTCAAATGAACTCGAGTTCATTTGACTTGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-480s1c1
Sequence:CCGGGCATCATATTCTCCAGGATATCTCGAGATATCCTGGAGAATATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-346s1c1
Sequence:CCGGGCTGCCTTGAAGAAAGAAGTTCTCGAGAACTTCTTTCTTCAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017736.2-372s1c1
Sequence:CCGGCATTAAGGCATCTACAGAGATCTCGAGATCTCTGTAGATGCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-781s1c1
Sequence:CCGGGAAATCATCAAAGCTGTCTGTCTCGAGACAGACAGCTTTGATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017736
THUMPD1 MISSION shRNA Lentiviral Transduction Particles
THUMP domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017736.3-516s21c1
Sequence:CCGGCGTTGTCTTCATCAGGACACTCTCGAGAGTGTCCTGATGAAGACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017736.3-862s21c1
Sequence:CCGGGAAATCATCAAAGCTGTCTGTCTCGAGACAGACAGCTTTGATGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-435s1c1
Sequence:CCGGCGTTGTCTTCATCAGGACACTCTCGAGAGTGTCCTGATGAAGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-1084s1c1
Sequence:CCGGGAAGGATCCAAGTCAAATGAACTCGAGTTCATTTGACTTGGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-480s1c1
Sequence:CCGGGCATCATATTCTCCAGGATATCTCGAGATATCCTGGAGAATATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-346s1c1
Sequence:CCGGGCTGCCTTGAAGAAAGAAGTTCTCGAGAACTTCTTTCTTCAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017736.2-372s1c1
Sequence:CCGGCATTAAGGCATCTACAGAGATCTCGAGATCTCTGTAGATGCCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017736.2-781s1c1
Sequence:CCGGGAAATCATCAAAGCTGTCTGTCTCGAGACAGACAGCTTTGATGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks