EMAIL THIS PAGE TO A FRIEND

THUMPD2

THUMP domain containing 2

Synonyms: C2orf8
UniProtKB ID: Q9BTF0, A8K7I7, Q53TT8, Q53TV0
Gene ID:
Mouse(72167) THUMP domain containing 2
Rat(313851) THUMP domain containing 2
Zebrafish(562797) THUMP domain containing 2
domestic cat(101095333) THUMP domain containing 2
chicken(421310) THUMP domain containing 2
dog(483044) THUMP domain containing 2
cow(509460) THUMP domain containing 2
sheep(101117836) THUMP domain containing 2
domestic guinea pig(100716930) THUMP domain containing 2
naked mole-rat(101710506) THUMP domain containing 2
Domestic Rabbit(100355850) THUMP domain containing 2
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025264 Rosetta Predictions human pricing
NM_001012108 Rosetta Predictions rat pricing
XM_575981 Rosetta Predictions rat pricing
XM_898870 Rosetta Predictions mouse pricing
XM_918052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134360 predicted 881
2 SASI_Hs01_00134361 predicted 579
3 SASI_Hs01_00134362 predicted 375
4 SASI_Hs01_00134363 predicted 732
5 SASI_Hs01_00134364 predicted 1343
6 SASI_Hs01_00134365 predicted 216
7 SASI_Hs02_00358116 predicted 370
8 SASI_Hs01_00134367 predicted 1537
9 SASI_Hs02_00358117 predicted 980
10 SASI_Hs01_00134369 predicted 1453
11 SASI_Hs01_00134366 predicted 1009
12 SASI_Hs01_00134368 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030071 predicted 981
2 SASI_Rn01_00030072 predicted 613
3 SASI_Rn01_00030073 predicted 1058
4 SASI_Rn01_00030074 predicted 452
5 SASI_Rn01_00030075 predicted 285
6 SASI_Rn01_00030076 predicted 966
7 SASI_Rn01_00030077 predicted 1062
8 SASI_Rn02_00200255 predicted 197
9 SASI_Rn01_00030078 predicted 1052
10 SASI_Rn01_00030079 predicted 959
11 SASI_Rn01_00030080 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163303 predicted 267
2 SASI_Rn01_00163304 predicted 434
3 SASI_Rn01_00163305 predicted 262
4 SASI_Rn01_00163306 predicted 454
5 SASI_Rn01_00163307 predicted 285
6 SASI_Rn01_00163308 predicted 466
7 SASI_Rn01_00163309 predicted 320
8 SASI_Rn01_00163310 predicted 437
9 SASI_Rn01_00163311 predicted 357
10 SASI_Rn01_00163312 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00429983 predicted 1483
2 SASI_Mm02_00429984 predicted 1422
3 SASI_Mm02_00429985 predicted 1447
4 SASI_Mm02_00429986 predicted 1425
5 SASI_Mm02_00429987 predicted 1442
6 SASI_Mm02_00429988 predicted 1426
7 SASI_Mm02_00429989 predicted 1440
8 SASI_Mm02_00429990 predicted 1435
9 SASI_Mm02_00429991 predicted 1557
10 SASI_Mm02_00429992 predicted 1510
11 SASI_Mm01_00229972 predicted 442
12 SASI_Mm01_00229973 predicted 706
13 SASI_Mm01_00229974 predicted 253
14 SASI_Mm01_00229975 predicted 835
15 SASI_Mm01_00229976 predicted 304
16 SASI_Mm01_00229977 predicted 329
17 SASI_Mm01_00229978 predicted 835
18 SASI_Mm01_00229979 predicted 664
19 SASI_Mm01_00229980 predicted 206
20 SASI_Mm01_00229981 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_918052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441620 predicted 439
2 SASI_Mm02_00441621 predicted 1478
3 SASI_Mm02_00441622 predicted 1112
4 SASI_Mm02_00441623 predicted 1334
5 SASI_Mm02_00441624 predicted 299
6 SASI_Mm02_00441625 predicted 324
7 SASI_Mm02_00441626 predicted 976
8 SASI_Mm02_00441627 predicted 1083
9 SASI_Mm02_00441628 predicted 195
10 SASI_Mm02_00441629 predicted 1324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025264
VALIDATED
THUMPD2 MISSION shRNA Bacterial Glycerol Stock
THUMP domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1455s1c1
Sequence:CCGGGAAAGACAGATGCGTTCATATCTCGAGATATGAACGCATCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025264.2-309s1c1
Sequence:CCGGGTTGGTTGAATGCCATTTCAACTCGAGTTGAAATGGCATTCAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1376s1c1
Sequence:CCGGGCCAGTAACCACAAATTCTTACTCGAGTAAGAATTTGTGGTTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1087s1c1
Sequence:CCGGGCCTTCAGAAAGTGTTGATATCTCGAGATATCAACACTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1438s1c1
Sequence:CCGGCTACAAAGTTAGCCTTGGAAACTCGAGTTTCCAAGGCTAACTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-377s1c1
Sequence:CCGGCAGAGAGATGATAACCAACTACTCGAGTAGTTGGTTATCATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1376s21c1
Sequence:CCGGGCCAGTAACCACAAATTCTTACTCGAGTAAGAATTTGTGGTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1438s21c1
Sequence:CCGGCTACAAAGTTAGCCTTGGAAACTCGAGTTTCCAAGGCTAACTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1455s21c1
Sequence:CCGGGAAAGACAGATGCGTTCATATCTCGAGATATGAACGCATCTGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-377s21c1
Sequence:CCGGCAGAGAGATGATAACCAACTACTCGAGTAGTTGGTTATCATCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1087s21c1
Sequence:CCGGGCCTTCAGAAAGTGTTGATATCTCGAGATATCAACACTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025264
VALIDATED
THUMPD2 MISSION shRNA shRNA Plasmid DNA
THUMP domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1455s1c1
Sequence:CCGGGAAAGACAGATGCGTTCATATCTCGAGATATGAACGCATCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025264.2-309s1c1
Sequence:CCGGGTTGGTTGAATGCCATTTCAACTCGAGTTGAAATGGCATTCAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1376s1c1
Sequence:CCGGGCCAGTAACCACAAATTCTTACTCGAGTAAGAATTTGTGGTTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1087s1c1
Sequence:CCGGGCCTTCAGAAAGTGTTGATATCTCGAGATATCAACACTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1438s1c1
Sequence:CCGGCTACAAAGTTAGCCTTGGAAACTCGAGTTTCCAAGGCTAACTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-377s1c1
Sequence:CCGGCAGAGAGATGATAACCAACTACTCGAGTAGTTGGTTATCATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1376s21c1
Sequence:CCGGGCCAGTAACCACAAATTCTTACTCGAGTAAGAATTTGTGGTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1438s21c1
Sequence:CCGGCTACAAAGTTAGCCTTGGAAACTCGAGTTTCCAAGGCTAACTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1455s21c1
Sequence:CCGGGAAAGACAGATGCGTTCATATCTCGAGATATGAACGCATCTGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-377s21c1
Sequence:CCGGCAGAGAGATGATAACCAACTACTCGAGTAGTTGGTTATCATCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1087s21c1
Sequence:CCGGGCCTTCAGAAAGTGTTGATATCTCGAGATATCAACACTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025264
VALIDATED
THUMPD2 MISSION shRNA Lentiviral Transduction Particles
THUMP domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1455s1c1
Sequence:CCGGGAAAGACAGATGCGTTCATATCTCGAGATATGAACGCATCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025264.2-309s1c1
Sequence:CCGGGTTGGTTGAATGCCATTTCAACTCGAGTTGAAATGGCATTCAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1376s1c1
Sequence:CCGGGCCAGTAACCACAAATTCTTACTCGAGTAAGAATTTGTGGTTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1087s1c1
Sequence:CCGGGCCTTCAGAAAGTGTTGATATCTCGAGATATCAACACTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-1438s1c1
Sequence:CCGGCTACAAAGTTAGCCTTGGAAACTCGAGTTTCCAAGGCTAACTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_025264.2-377s1c1
Sequence:CCGGCAGAGAGATGATAACCAACTACTCGAGTAGTTGGTTATCATCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1376s21c1
Sequence:CCGGGCCAGTAACCACAAATTCTTACTCGAGTAAGAATTTGTGGTTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1438s21c1
Sequence:CCGGCTACAAAGTTAGCCTTGGAAACTCGAGTTTCCAAGGCTAACTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1455s21c1
Sequence:CCGGGAAAGACAGATGCGTTCATATCTCGAGATATGAACGCATCTGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-377s21c1
Sequence:CCGGCAGAGAGATGATAACCAACTACTCGAGTAGTTGGTTATCATCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025264.3-1087s21c1
Sequence:CCGGGCCTTCAGAAAGTGTTGATATCTCGAGATATCAACACTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028138
VALIDATED
THUMPD2 MISSION shRNA Bacterial Glycerol Stock
THUMP domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-1255s21c1
Sequence:CCGGAGATCACCACCGGCATCTTACCTCGAGGTAAGATGCCGGTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-1069s21c1
Sequence:CCGGAGACAGGATTGAGTTACTTAACTCGAGTTAAGTAACTCAATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-895s21c1
Sequence:CCGGGGCGTCCATTGCAGAAATTAACTCGAGTTAATTTCTGCAATGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028138.1-1121s21c1
Sequence:CCGGCAAAGTACGGATGTTATTATTCTCGAGAATAATAACATCCGTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028138.1-1684s21c1
Sequence:CCGGTGCCTTGGACTCTCCAGTATCCTCGAGGATACTGGAGAGTCCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028138
VALIDATED
THUMPD2 MISSION shRNA shRNA Plasmid DNA
THUMP domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-1255s21c1
Sequence:CCGGAGATCACCACCGGCATCTTACCTCGAGGTAAGATGCCGGTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-1069s21c1
Sequence:CCGGAGACAGGATTGAGTTACTTAACTCGAGTTAAGTAACTCAATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-895s21c1
Sequence:CCGGGGCGTCCATTGCAGAAATTAACTCGAGTTAATTTCTGCAATGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028138.1-1121s21c1
Sequence:CCGGCAAAGTACGGATGTTATTATTCTCGAGAATAATAACATCCGTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028138.1-1684s21c1
Sequence:CCGGTGCCTTGGACTCTCCAGTATCCTCGAGGATACTGGAGAGTCCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028138
VALIDATED
THUMPD2 MISSION shRNA Lentiviral Transduction Particles
THUMP domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-1255s21c1
Sequence:CCGGAGATCACCACCGGCATCTTACCTCGAGGTAAGATGCCGGTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-1069s21c1
Sequence:CCGGAGACAGGATTGAGTTACTTAACTCGAGTTAAGTAACTCAATCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028138.1-895s21c1
Sequence:CCGGGGCGTCCATTGCAGAAATTAACTCGAGTTAATTTCTGCAATGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028138.1-1121s21c1
Sequence:CCGGCAAAGTACGGATGTTATTATTCTCGAGAATAATAACATCCGTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028138.1-1684s21c1
Sequence:CCGGTGCCTTGGACTCTCCAGTATCCTCGAGGATACTGGAGAGTCCAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks