EMAIL THIS PAGE TO A FRIEND

THUMPD3

THUMP domain containing 3

UniProtKB ID: Q9BV44, Q9H8V6, Q9NVC1, Q9UFS3
Gene ID:
Mouse(14911) THUMP domain containing 3
Rat(500288) THUMP domain containing 3
naked mole-rat(101719405) THUMP domain containing 3
domestic guinea pig(100732259) THUMP domain containing 3
cow(508940) THUMP domain containing 3
sheep(101106115) THUMP domain containing 3
Zebrafish(561938) THUMP domain containing 3
domestic cat(101082638) THUMP domain containing 3
dog(610222) THUMP domain containing 3
chicken(416116) THUMP domain containing 3
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114092 Rosetta Predictions human pricing
NM_015453 Rosetta Predictions human pricing
XM_001078607 Rosetta Predictions rat pricing
XM_575638 Rosetta Predictions rat pricing
NM_008188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326184 predicted 1209
2 SASI_Hs02_00326185 predicted 1461
3 SASI_Hs02_00326186 predicted 1211
4 SASI_Hs02_00326187 predicted 851
5 SASI_Hs02_00326188 predicted 1410
6 SASI_Hs02_00326189 predicted 1043
7 SASI_Hs02_00326190 predicted 1343
8 SASI_Hs02_00326191 predicted 1579
9 SASI_Hs02_00326192 predicted 1095
10 SASI_Hs02_00326193 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347851 predicted 1411
2 SASI_Hs01_00181413 predicted 1670
3 SASI_Hs01_00181414 predicted 1416
4 SASI_Hs01_00181415 predicted 1053
5 SASI_Hs01_00181417 predicted 1608
6 SASI_Hs01_00181418 predicted 1242
7 SASI_Hs01_00181419 predicted 1550
8 SASI_Hs01_00181420 predicted 1786
9 SASI_Hs02_00347852 predicted 1301
10 SASI_Hs02_00347853 predicted 1075
11 SASI_Hs01_00181412 predicted 1365
12 SASI_Hs01_00181416 predicted 507
13 SASI_Hs01_00181421 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361422 predicted 648
2 SASI_Rn02_00361423 predicted 1323
3 SASI_Rn02_00361424 predicted 324
4 SASI_Rn02_00361425 predicted 899
5 SASI_Rn02_00361426 predicted 1916
6 SASI_Rn02_00361427 predicted 906
7 SASI_Rn02_00361428 predicted 753
8 SASI_Rn02_00361429 predicted 1877
9 SASI_Rn02_00361430 predicted 391
10 SASI_Rn02_00361431 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403971 predicted 646
2 SASI_Rn02_00403972 predicted 1315
3 SASI_Rn02_00403973 predicted 320
4 SASI_Rn02_00403974 predicted 903
5 SASI_Rn02_00403975 predicted 1919
6 SASI_Rn02_00403976 predicted 898
7 SASI_Rn02_00403977 predicted 751
8 SASI_Rn02_00403978 predicted 1876
9 SASI_Rn02_00403979 predicted 394
10 SASI_Rn02_00403980 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146915 predicted 493
2 SASI_Mm01_00146916 predicted 846
3 SASI_Mm01_00146917 predicted 886
4 SASI_Mm01_00146918 predicted 541
5 SASI_Mm01_00146919 predicted 1183
6 SASI_Mm02_00313331 predicted 1314
7 SASI_Mm01_00146920 predicted 1629
8 SASI_Mm01_00146921 predicted 1048
9 SASI_Mm01_00146923 predicted 1591
10 SASI_Mm01_00146924 predicted 646
11 SASI_Mm01_00146922 predicted 1172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008188
VALIDATED
THUMPD3 MISSION shRNA Bacterial Glycerol Stock
THUMP domain containing 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-1198s21c1
Sequence:CCGGCTATTGACTAAGAGCCAGATTCTCGAGAATCTGGCTCTTAGTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-854s21c1
Sequence:CCGGGTGCTATTCAAGAGTACTTTACTCGAGTAAAGTACTCTTGAATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008188.2-1763s21c1
Sequence:CCGGGCAAGGTGATTGTAATGGTATCTCGAGATACCATTACAATCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-828s21c1
Sequence:CCGGCAATGAGGCTGCGAGAGATTTCTCGAGAAATCTCTCGCAGCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-306s21c1
Sequence:CCGGAGACCGCGGAAAGATCTATTTCTCGAGAAATAGATCTTTCCGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008188.2-1462s1c1
Sequence:CCGGGCCTTATCTGGAATGGGACATCTCGAGATGTCCCATTCCAGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008188.2-415s1c1
Sequence:CCGGCAGTTCAAAGATACGAAGGAACTCGAGTTCCTTCGTATCTTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-643s1c1
Sequence:CCGGGATTCACATATCTTGGACTATCTCGAGATAGTCCAAGATATGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-433s1c1
Sequence:CCGGGAAGAAGTTCTAAGAGACTTTCTCGAGAAAGTCTCTTAGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-1763s1c1
Sequence:CCGGGCAAGGTGATTGTAATGGTATCTCGAGATACCATTACAATCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-1198s1c1
Sequence:CCGGCTATTGACTAAGAGCCAGATTCTCGAGAATCTGGCTCTTAGTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008188.2-1497s1c1
Sequence:CCGGCCATGTAGTCTGGGTGAACATCTCGAGATGTTCACCCAGACTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008188.2-1795s1c1
Sequence:CCGGCCTACACTGCTTGGCTTCTAACTCGAGTTAGAAGCCAAGCAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008188
VALIDATED
THUMPD3 MISSION shRNA shRNA Plasmid DNA
THUMP domain containing 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-1198s21c1
Sequence:CCGGCTATTGACTAAGAGCCAGATTCTCGAGAATCTGGCTCTTAGTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-854s21c1
Sequence:CCGGGTGCTATTCAAGAGTACTTTACTCGAGTAAAGTACTCTTGAATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008188.2-1763s21c1
Sequence:CCGGGCAAGGTGATTGTAATGGTATCTCGAGATACCATTACAATCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-828s21c1
Sequence:CCGGCAATGAGGCTGCGAGAGATTTCTCGAGAAATCTCTCGCAGCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-306s21c1
Sequence:CCGGAGACCGCGGAAAGATCTATTTCTCGAGAAATAGATCTTTCCGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008188.2-1462s1c1
Sequence:CCGGGCCTTATCTGGAATGGGACATCTCGAGATGTCCCATTCCAGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008188.2-415s1c1
Sequence:CCGGCAGTTCAAAGATACGAAGGAACTCGAGTTCCTTCGTATCTTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-643s1c1
Sequence:CCGGGATTCACATATCTTGGACTATCTCGAGATAGTCCAAGATATGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-433s1c1
Sequence:CCGGGAAGAAGTTCTAAGAGACTTTCTCGAGAAAGTCTCTTAGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-1763s1c1
Sequence:CCGGGCAAGGTGATTGTAATGGTATCTCGAGATACCATTACAATCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-1198s1c1
Sequence:CCGGCTATTGACTAAGAGCCAGATTCTCGAGAATCTGGCTCTTAGTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008188.2-1497s1c1
Sequence:CCGGCCATGTAGTCTGGGTGAACATCTCGAGATGTTCACCCAGACTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008188.2-1795s1c1
Sequence:CCGGCCTACACTGCTTGGCTTCTAACTCGAGTTAGAAGCCAAGCAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008188
VALIDATED
THUMPD3 MISSION shRNA Lentiviral Transduction Particles
THUMP domain containing 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-1198s21c1
Sequence:CCGGCTATTGACTAAGAGCCAGATTCTCGAGAATCTGGCTCTTAGTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-854s21c1
Sequence:CCGGGTGCTATTCAAGAGTACTTTACTCGAGTAAAGTACTCTTGAATAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008188.2-1763s21c1
Sequence:CCGGGCAAGGTGATTGTAATGGTATCTCGAGATACCATTACAATCACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-828s21c1
Sequence:CCGGCAATGAGGCTGCGAGAGATTTCTCGAGAAATCTCTCGCAGCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008188.2-306s21c1
Sequence:CCGGAGACCGCGGAAAGATCTATTTCTCGAGAAATAGATCTTTCCGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008188.2-1462s1c1
Sequence:CCGGGCCTTATCTGGAATGGGACATCTCGAGATGTCCCATTCCAGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008188.2-415s1c1
Sequence:CCGGCAGTTCAAAGATACGAAGGAACTCGAGTTCCTTCGTATCTTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-643s1c1
Sequence:CCGGGATTCACATATCTTGGACTATCTCGAGATAGTCCAAGATATGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-433s1c1
Sequence:CCGGGAAGAAGTTCTAAGAGACTTTCTCGAGAAAGTCTCTTAGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-1763s1c1
Sequence:CCGGGCAAGGTGATTGTAATGGTATCTCGAGATACCATTACAATCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008188.2-1198s1c1
Sequence:CCGGCTATTGACTAAGAGCCAGATTCTCGAGAATCTGGCTCTTAGTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008188.2-1497s1c1
Sequence:CCGGCCATGTAGTCTGGGTGAACATCTCGAGATGTTCACCCAGACTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008188.2-1795s1c1
Sequence:CCGGCCTACACTGCTTGGCTTCTAACTCGAGTTAGAAGCCAAGCAGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015453
THUMPD3 MISSION shRNA Bacterial Glycerol Stock
THUMP domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015453.1-2600s1c1
Sequence:CCGGCCTGAAGGAATGAAGCATTATCTCGAGATAATGCTTCATTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1278s1c1
Sequence:CCGGGTGATCCTCTACCTTATGATACTCGAGTATCATAAGGTAGAGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1582s1c1
Sequence:CCGGGAAGAGAAACTGGAACCTTTACTCGAGTAAAGGTTCCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-1763s1c1
Sequence:CCGGGCTGCAGTTTACGTTCTGATACTCGAGTATCAGAACGTAAACTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-365s1c1
Sequence:CCGGCTCCTAGATGTGAACCTTCATCTCGAGATGAAGGTTCACATCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-995s1c1
Sequence:CCGGGAGCCTCAAGTGCTGAAGTTTCTCGAGAAACTTCAGCACTTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1704s1c1
Sequence:CCGGGAATGCAACACGTATGGCGAACTCGAGTTCGCCATACGTGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1809s1c1
Sequence:CCGGCTTCAGAACAAGACGGAGAAACTCGAGTTTCTCCGTCTTGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-1115s1c1
Sequence:CCGGGCCGACATGACCAACTTTGATCTCGAGATCAAAGTTGGTCATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-865s1c1
Sequence:CCGGCCATGCTTTAGATTCTCATATCTCGAGATATGAGAATCTAAAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015453
THUMPD3 MISSION shRNA shRNA Plasmid DNA
THUMP domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015453.1-2600s1c1
Sequence:CCGGCCTGAAGGAATGAAGCATTATCTCGAGATAATGCTTCATTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1278s1c1
Sequence:CCGGGTGATCCTCTACCTTATGATACTCGAGTATCATAAGGTAGAGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1582s1c1
Sequence:CCGGGAAGAGAAACTGGAACCTTTACTCGAGTAAAGGTTCCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-1763s1c1
Sequence:CCGGGCTGCAGTTTACGTTCTGATACTCGAGTATCAGAACGTAAACTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-365s1c1
Sequence:CCGGCTCCTAGATGTGAACCTTCATCTCGAGATGAAGGTTCACATCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-995s1c1
Sequence:CCGGGAGCCTCAAGTGCTGAAGTTTCTCGAGAAACTTCAGCACTTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1704s1c1
Sequence:CCGGGAATGCAACACGTATGGCGAACTCGAGTTCGCCATACGTGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1809s1c1
Sequence:CCGGCTTCAGAACAAGACGGAGAAACTCGAGTTTCTCCGTCTTGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-1115s1c1
Sequence:CCGGGCCGACATGACCAACTTTGATCTCGAGATCAAAGTTGGTCATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-865s1c1
Sequence:CCGGCCATGCTTTAGATTCTCATATCTCGAGATATGAGAATCTAAAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015453
THUMPD3 MISSION shRNA Lentiviral Transduction Particles
THUMP domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015453.1-2600s1c1
Sequence:CCGGCCTGAAGGAATGAAGCATTATCTCGAGATAATGCTTCATTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1278s1c1
Sequence:CCGGGTGATCCTCTACCTTATGATACTCGAGTATCATAAGGTAGAGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1582s1c1
Sequence:CCGGGAAGAGAAACTGGAACCTTTACTCGAGTAAAGGTTCCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-1763s1c1
Sequence:CCGGGCTGCAGTTTACGTTCTGATACTCGAGTATCAGAACGTAAACTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-365s1c1
Sequence:CCGGCTCCTAGATGTGAACCTTCATCTCGAGATGAAGGTTCACATCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-995s1c1
Sequence:CCGGGAGCCTCAAGTGCTGAAGTTTCTCGAGAAACTTCAGCACTTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1704s1c1
Sequence:CCGGGAATGCAACACGTATGGCGAACTCGAGTTCGCCATACGTGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015453.1-1809s1c1
Sequence:CCGGCTTCAGAACAAGACGGAGAAACTCGAGTTTCTCCGTCTTGTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-1115s1c1
Sequence:CCGGGCCGACATGACCAACTTTGATCTCGAGATCAAAGTTGGTCATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015453.1-865s1c1
Sequence:CCGGCCATGCTTTAGATTCTCATATCTCGAGATATGAGAATCTAAAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks