EMAIL THIS PAGE TO A FRIEND

THY1

Thy-1 cell surface antigen

Synonyms: CD90
UniProtKB ID: P04216, Q16008, Q9NSP1
Gene ID:
Mouse(21838) thymus cell antigen 1, theta
Rat(24832) Thy-1 cell surface antigen
Zebrafish(336617) Thy-1 cell surface antigen
dog(489365) Thy-1 cell surface antigen
domestic cat(101098005) Thy-1 cell surface antigen
Horse(100063377) Thy-1 cell surface antigen
chicken(378897) Thy-1 cell surface antigen
cow(614712) Thy-1 cell surface antigen
sheep(101109906) Thy-1 cell surface antigen
domestic guinea pig(100379563) thymus cell antigen 1, theta
naked mole-rat(101713632) Thy-1 cell surface antigen
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501275 Anti-THY1 antibody produced in goat affinity isolated antibody human, pig
ELISA, western blot pricing
HPA003733 Anti-THY1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4700719 Monoclonal Anti-CD90-APC antibody produced in mouse clone 5E10, purified immunoglobulin, buffered aqueous solution human, dog, nonhuman primates, pig
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4700706 Monoclonal Anti-CD90-FITC antibody produced in mouse clone 5E10, purified immunoglobulin, buffered aqueous solution pig, dog, human, nonhuman primates
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4700686 Monoclonal Anti-CD90-PE antibody produced in mouse clone 5E10, purified immunoglobulin, buffered aqueous solution human, pig, nonhuman primates, dog
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4700594 Monoclonal Anti-CD90.2, azide free antibody produced in mouse clone 1aG4/C5, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
M7898 Monoclonal Anti-Thy 1.1 antibody produced in mouse clone TN-26, purified immunoglobulin, buffered aqueous solution mouse
complement-mediated cytotoxicity assay, immunofluorescence pricing
WH0007070M1 Monoclonal Anti-THY1 antibody produced in mouse clone 3F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200497 Monoclonal Anti-THY1 antibody produced in mouse ~1.0 mg/mL, purified immunoglobulin human, rat, mouse
flow cytometry, western blot pricing
AMAB90846 Monoclonal Anti-THY1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1040, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90844 Monoclonal Anti-THY1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1028, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006288 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078001 MISSION® esiRNA esiRNA targeting mouse Thy1 (esiRNA1) mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABF461 Anti-CD90.2 Antibody (mouse), APC, clone 30-H12 100 µg, This rat monoclonal antibody Anti-CD90.2 (mouse), APC & clone 30-H12 validated for use in Flow Cytometry for the detection of CD90.2. pricing
MABF729 Anti-CD90.2 Antibody (mouse), APC, clone 30-H12 25 µg, This rat monoclonal antibody Anti-CD90.2 (mouse), APC & clone 30-H12 validated for use in Flow Cytometry for the detection of CD90.2. pricing
MABF460 Anti-CD90.2 Antibody (mouse), PE-Cy7, clone 30-H12 100 µg, This rat monoclonal antibody Anti-CD90.2 (mouse), PE-Cy7 & clone 30-H12 validated for use in Flow Cytometry for the detection of CD90.2. pricing
MABF728 Anti-CD90.2 Antibody (mouse), PE-Cy7, clone 30-H12 25 µg, This rat monoclonal antibody Anti-CD90.2 (mouse), PE-Cy7 & clone 30-H12 validated for use in Flow Cytometry for the detection of CD90.2. pricing
MABF144D Anti-CD90.2 (mouse), FITC, clone 30-H12 Antibody 25 μg, This rat monoclonal Anti-CD90.2 Antibody (mouse), FITC, clone 30-H12, Cat. No. MABF1448 is validated for use in Flow Cytometry, for the detection of CD90.2. pricing
MABF145A Anti-CD90.2 (mouse), violetFluor™ 450, clone 30-H12 Antibody 25 μg, Anti-CD90.2 (mouse), violetFluor™ 450, clone 30-H12 Antibody is an antibody against CD90.2 for use in Flow Cytometry. pricing
MAB1406 Anti-Thy-1.1 Antibody, clone OX-7 100 µg, Anti-Thy-1.1 Antibody, clone OX-7 detects level of Thy-1.1 & has been published & validated for use in FC, IC, IH. pricing
MABF1961 Anti-Thy 1.1 (CD90) Antibody, clone T11D7e 200 µL, This mouse monoclonal Anti-Thy 1.1 (CD90), clone T11D7e, Cat. No. MABF1961 is validated for use in Flow Cytometry for the detection of Thy-1 membrane glycoprotein, CD90. pricing
CBL415 Anti-Thy-1 Antibody, clone F15-42-1 100 µg, Anti-Thy-1 Antibody, clone F15-42-1 is an antibody against Thy-1 for use in FC, IP, IH. pricing
CBL415F Anti-Thy-1 Antibody, clone F15-42-1, FITC conjugated 100 assays, This Anti-Thy-1 Antibody, clone F15-42-1, FITC conjugated is validated for use in FC for the detection of Thy-1. pricing
CBL415P Anti-Thy-1 Antibody, clone F15-42-1, Phycoerythrin conjugated 100 assays, Detect Thy-1 using this Anti-Thy-1 Antibody, clone F15-42-1, Phycoerythrin conjugated validated for use in FC. pricing
MABF34 Anti-Thy-1 Antibody, clone M5/49 100 µg, Anti-Thy-1 Antibody, clone M5/49 detects level of Thy-1 & has been published & validated for use in WB. pricing
CBL1500F Anti-Thy-1 Antibody, clone OX-7, FITC conjugated 100 assays, Anti-Thy-1 Antibody, clone OX-7, FITC conjugated is an antibody against Thy-1 for use in FC & IC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006288 Rosetta Predictions human pricing
NM_012673 Rosetta Predictions rat pricing
NM_009382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088784 predicted 428
2 SASI_Hs01_00088786 predicted 281
3 SASI_Hs02_00341276 predicted 767
4 SASI_Hs01_00088787 predicted 675
5 SASI_Hs01_00088789 predicted 726
6 SASI_Hs01_00088790 predicted 314
7 SASI_Hs01_00088791 predicted 674
8 SASI_Hs01_00088792 predicted 265
9 SASI_Hs02_00341277 predicted 769
10 SASI_Hs01_00088793 predicted 268
11 SASI_Hs01_00088785 predicted 410
12 SASI_Hs01_00088788 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060645 predicted 425
2 SASI_Rn01_00060646 predicted 291
3 SASI_Rn01_00060648 predicted 357
4 SASI_Rn01_00060649 predicted 338
5 SASI_Rn01_00060650 predicted 343
6 SASI_Rn01_00060651 predicted 338
7 SASI_Rn01_00060652 predicted 289
8 SASI_Rn02_00259948 predicted 392
9 SASI_Rn01_00060653 predicted 336
10 SASI_Rn01_00060654 predicted 422
11 SASI_Rn01_00060647 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111621 predicted 446
2 SASI_Mm02_00315994 predicted 225
3 SASI_Mm02_00315995 predicted 355
4 SASI_Mm02_00315996 predicted 497
5 SASI_Mm01_00111624 predicted 353
6 SASI_Mm02_00315997 predicted 233
7 SASI_Mm02_00315998 predicted 244
8 SASI_Mm02_00315999 predicted 409
9 SASI_Mm01_00111628 predicted 972
10 SASI_Mm01_00111629 predicted 585
11 SASI_Mm01_00111620 predicted 425
12 SASI_Mm01_00111622 predicted 383
13 SASI_Mm01_00111623 predicted 406
14 SASI_Mm01_00111625 predicted 317
15 SASI_Mm01_00111626 predicted 307
16 SASI_Mm01_00111627 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006288
THY1 MISSION shRNA Bacterial Glycerol Stock
Thy-1 cell surface antigen
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-172s1c1
Sequence:CCGGGCCATGAGAATACCAGCAGTTCTCGAGAACTGCTGGTATTCTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-285s1c1
Sequence:CCGGCGAACCAACTTCACCAGCAAACTCGAGTTTGCTGGTGAAGTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-296s1c1
Sequence:CCGGCACCAGCAAATACAACATGAACTCGAGTTCATGTTGTATTTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-414s1c1
Sequence:CCGGGTCACAGTGCTCAGAGACAAACTCGAGTTTGTCTCTGAGCACTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-422s1c1
Sequence:CCGGGCTCAGAGACAAACTGGTCAACTCGAGTTGACCAGTTTGTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006288
THY1 MISSION shRNA shRNA Plasmid DNA
Thy-1 cell surface antigen
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-172s1c1
Sequence:CCGGGCCATGAGAATACCAGCAGTTCTCGAGAACTGCTGGTATTCTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-285s1c1
Sequence:CCGGCGAACCAACTTCACCAGCAAACTCGAGTTTGCTGGTGAAGTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-296s1c1
Sequence:CCGGCACCAGCAAATACAACATGAACTCGAGTTCATGTTGTATTTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-414s1c1
Sequence:CCGGGTCACAGTGCTCAGAGACAAACTCGAGTTTGTCTCTGAGCACTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-422s1c1
Sequence:CCGGGCTCAGAGACAAACTGGTCAACTCGAGTTGACCAGTTTGTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006288
THY1 MISSION shRNA Lentiviral Transduction Particles
Thy-1 cell surface antigen
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-172s1c1
Sequence:CCGGGCCATGAGAATACCAGCAGTTCTCGAGAACTGCTGGTATTCTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-285s1c1
Sequence:CCGGCGAACCAACTTCACCAGCAAACTCGAGTTTGCTGGTGAAGTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-296s1c1
Sequence:CCGGCACCAGCAAATACAACATGAACTCGAGTTCATGTTGTATTTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-414s1c1
Sequence:CCGGGTCACAGTGCTCAGAGACAAACTCGAGTTTGTCTCTGAGCACTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006288.2-422s1c1
Sequence:CCGGGCTCAGAGACAAACTGGTCAACTCGAGTTGACCAGTTTGTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009382
THY1 MISSION shRNA Bacterial Glycerol Stock
Thy-1 cell surface antigen
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-149s1c1
Sequence:CCGGTGAGAATAACACCAAGGATAACTCGAGTTATCCTTGGTGTTATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-363s1c1
Sequence:CCGGGCGAATCCCATGAGCTCCAATCTCGAGATTGGAGCTCATGGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-143s1c1
Sequence:CCGGCCGCCATGAGAATAACACCAACTCGAGTTGGTGTTATTCTCATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-398s1c1
Sequence:CCGGGTATAGAGACAAGCTGGTCAACTCGAGTTGACCAGCTTGTCTCTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-279s1c1
Sequence:CCGGCAGCCCTATATCAAGGTCCTTCTCGAGAAGGACCTTGATATAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009382
THY1 MISSION shRNA shRNA Plasmid DNA
Thy-1 cell surface antigen
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-149s1c1
Sequence:CCGGTGAGAATAACACCAAGGATAACTCGAGTTATCCTTGGTGTTATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-363s1c1
Sequence:CCGGGCGAATCCCATGAGCTCCAATCTCGAGATTGGAGCTCATGGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-143s1c1
Sequence:CCGGCCGCCATGAGAATAACACCAACTCGAGTTGGTGTTATTCTCATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-398s1c1
Sequence:CCGGGTATAGAGACAAGCTGGTCAACTCGAGTTGACCAGCTTGTCTCTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-279s1c1
Sequence:CCGGCAGCCCTATATCAAGGTCCTTCTCGAGAAGGACCTTGATATAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009382
THY1 MISSION shRNA Lentiviral Transduction Particles
Thy-1 cell surface antigen
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-149s1c1
Sequence:CCGGTGAGAATAACACCAAGGATAACTCGAGTTATCCTTGGTGTTATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-363s1c1
Sequence:CCGGGCGAATCCCATGAGCTCCAATCTCGAGATTGGAGCTCATGGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-143s1c1
Sequence:CCGGCCGCCATGAGAATAACACCAACTCGAGTTGGTGTTATTCTCATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-398s1c1
Sequence:CCGGGTATAGAGACAAGCTGGTCAACTCGAGTTGACCAGCTTGTCTCTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009382.2-279s1c1
Sequence:CCGGCAGCCCTATATCAAGGTCCTTCTCGAGAAGGACCTTGATATAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks