EMAIL THIS PAGE TO A FRIEND

THYN1

thymocyte nuclear protein 1

Synonyms: MDS012 MY105 THY28 THY28KD
UniProtKB ID: Q9P016, Q567Q2, Q9H3L4, Q9HC20
Gene ID:
Human(29087) Summary: This gene encodes a protein that is highly conserved among vertebrates and plant species and may be involved in the induction of apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(77862) thymocyte nuclear protein 1
Rat(300470) thymocyte nuclear protein 1
domestic guinea pig(100734916) thymocyte nuclear protein 1
naked mole-rat(101708042) thymocyte nuclear protein 1
cow(616441) thymocyte nuclear protein 1
sheep(101114051) thymocyte nuclear protein 1
Zebrafish(393630) thymocyte nuclear protein 1
dog(489268) thymocyte nuclear protein 1
domestic cat(101097516) thymocyte nuclear protein 1
chicken(374161) thymocyte nuclear protein 1
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199297 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037304 Rosetta Predictions human pricing
NM_001037305 Rosetta Predictions human pricing
NM_014174 Rosetta Predictions human pricing
NM_199297 Rosetta Predictions human pricing
NM_199298 Rosetta Predictions human pricing
NM_001007661 Rosetta Predictions rat pricing
NM_144543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308255 predicted 321
2 SASI_Hs01_00027127 predicted 296
3 SASI_Hs01_00027128 predicted 359
4 SASI_Hs01_00027130 predicted 282
5 SASI_Hs01_00027131 predicted 287
6 SASI_Hs01_00027132 predicted 282
7 SASI_Hs01_00027133 predicted 293
8 SASI_Hs01_00027134 predicted 298
9 SASI_Hs01_00027135 predicted 288
10 SASI_Hs02_00308256 predicted 351
11 SASI_Hs01_00027126 predicted 307
12 SASI_Hs01_00027129 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308257 predicted 327
2 SASI_Hs01_00064301 predicted 289
3 SASI_Hs01_00064302 predicted 360
4 SASI_Hs01_00064304 predicted 287
5 SASI_Hs01_00064305 predicted 281
6 SASI_Hs01_00064306 predicted 283
7 SASI_Hs01_00064307 predicted 289
8 SASI_Hs01_00064308 predicted 297
9 SASI_Hs01_00064309 predicted 287
10 SASI_Hs02_00308258 predicted 351
11 SASI_Hs01_00064300 predicted 314
12 SASI_Hs01_00064303 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345181 predicted 710
2 SASI_Hs01_00063194 predicted 670
3 SASI_Hs01_00063195 predicted 735
4 SASI_Hs01_00063197 predicted 663
5 SASI_Hs01_00063198 predicted 667
6 SASI_Hs01_00063199 predicted 664
7 SASI_Hs01_00063200 predicted 676
8 SASI_Hs01_00063201 predicted 678
9 SASI_Hs01_00063202 predicted 670
10 SASI_Hs02_00345182 predicted 733
11 SASI_Hs01_00063193 predicted 697
12 SASI_Hs01_00063196 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372723 predicted 395
2 SASI_Hs01_00023261 predicted 363
3 SASI_Hs01_00023262 predicted 432
4 SASI_Hs01_00023264 predicted 353
5 SASI_Hs01_00023265 predicted 356
6 SASI_Hs01_00023266 predicted 352
7 SASI_Hs01_00023267 predicted 362
8 SASI_Hs01_00023268 predicted 364
9 SASI_Hs01_00023269 predicted 362
10 SASI_Hs02_00372724 predicted 431
11 SASI_Hs01_00023260 predicted 379
12 SASI_Hs01_00023263 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372725 predicted 397
2 SASI_Hs01_00184881 predicted 367
3 SASI_Hs01_00184882 predicted 425
4 SASI_Hs01_00184884 predicted 354
5 SASI_Hs01_00184885 predicted 359
6 SASI_Hs01_00184886 predicted 355
7 SASI_Hs01_00184887 predicted 361
8 SASI_Hs01_00184888 predicted 368
9 SASI_Hs01_00184889 predicted 358
10 SASI_Hs02_00372726 predicted 431
11 SASI_Hs01_00184880 predicted 381
12 SASI_Hs01_00184883 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060219 predicted 230
2 SASI_Rn01_00060220 predicted 515
3 SASI_Rn01_00060221 predicted 602
4 SASI_Rn01_00060222 predicted 516
5 SASI_Rn01_00060223 predicted 423
6 SASI_Rn02_00198787 predicted 327
7 SASI_Rn01_00060224 predicted 545
8 SASI_Rn01_00060225 predicted 612
9 SASI_Rn01_00060226 predicted 262
10 SASI_Rn01_00060227 predicted 233
11 SASI_Rn01_00060218 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340075 predicted 340
2 SASI_Mm01_00159267 predicted 629
3 SASI_Mm01_00159268 predicted 296
4 SASI_Mm02_00340076 predicted 236
5 SASI_Mm01_00159270 predicted 294
6 SASI_Mm01_00159271 predicted 630
7 SASI_Mm02_00340077 predicted 338
8 SASI_Mm01_00159273 predicted 433
9 SASI_Mm01_00159274 predicted 625
10 SASI_Mm02_00340078 predicted 604
11 SASI_Mm01_00159269 predicted 519
12 SASI_Mm01_00159272 predicted 509
13 SASI_Mm01_00159275 predicted 506
14 SASI_Mm01_00159276 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199297
THYN1 MISSION shRNA Bacterial Glycerol Stock
thymocyte nuclear protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199297.1-702s1c1
Sequence:CCGGCTGAGATACTGCTGCTGGAATCTCGAGATTCCAGCAGCAGTATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-510s1c1
Sequence:CCGGCTTCTACCATAGCAACTGCAACTCGAGTTGCAGTTGCTATGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199297.1-378s1c1
Sequence:CCGGGAAAGGTGTAGATGTGAAGTTCTCGAGAACTTCACATCTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-555s1c1
Sequence:CCGGGAAGATCGTGAAAGAGGCTTACTCGAGTAAGCCTCTTTCACGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-215s1c1
Sequence:CCGGCAGACAAGGGACTATCAGGAACTCGAGTTCCTGATAGTCCCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-517s1c1
Sequence:CCGGCATAGCAACTGCAAAGAGCCACTCGAGTGGCTCTTTGCAGTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-409s1c1
Sequence:CCGGGATCTCAAAGCACAGCCCAAACTCGAGTTTGGGCTGTGCTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199297.1-647s21c1
Sequence:CCGGGGTCCATGAAGAGTTTGATTTCTCGAGAAATCAAACTCTTCATGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199297.1-690s21c1
Sequence:CCGGGAACCAAGTTAACTGAGATACCTCGAGGTATCTCAGTTAACTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199297.1-370s21c1
Sequence:CCGGCGCCTAGAGAAAGGTGTAGATCTCGAGATCTACACCTTTCTCTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199297
THYN1 MISSION shRNA shRNA Plasmid DNA
thymocyte nuclear protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199297.1-702s1c1
Sequence:CCGGCTGAGATACTGCTGCTGGAATCTCGAGATTCCAGCAGCAGTATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-510s1c1
Sequence:CCGGCTTCTACCATAGCAACTGCAACTCGAGTTGCAGTTGCTATGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199297.1-378s1c1
Sequence:CCGGGAAAGGTGTAGATGTGAAGTTCTCGAGAACTTCACATCTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-555s1c1
Sequence:CCGGGAAGATCGTGAAAGAGGCTTACTCGAGTAAGCCTCTTTCACGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-215s1c1
Sequence:CCGGCAGACAAGGGACTATCAGGAACTCGAGTTCCTGATAGTCCCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-517s1c1
Sequence:CCGGCATAGCAACTGCAAAGAGCCACTCGAGTGGCTCTTTGCAGTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-409s1c1
Sequence:CCGGGATCTCAAAGCACAGCCCAAACTCGAGTTTGGGCTGTGCTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199297.1-647s21c1
Sequence:CCGGGGTCCATGAAGAGTTTGATTTCTCGAGAAATCAAACTCTTCATGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199297.1-690s21c1
Sequence:CCGGGAACCAAGTTAACTGAGATACCTCGAGGTATCTCAGTTAACTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199297.1-370s21c1
Sequence:CCGGCGCCTAGAGAAAGGTGTAGATCTCGAGATCTACACCTTTCTCTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199297
THYN1 MISSION shRNA Lentiviral Transduction Particles
thymocyte nuclear protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199297.1-702s1c1
Sequence:CCGGCTGAGATACTGCTGCTGGAATCTCGAGATTCCAGCAGCAGTATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-510s1c1
Sequence:CCGGCTTCTACCATAGCAACTGCAACTCGAGTTGCAGTTGCTATGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199297.1-378s1c1
Sequence:CCGGGAAAGGTGTAGATGTGAAGTTCTCGAGAACTTCACATCTACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-555s1c1
Sequence:CCGGGAAGATCGTGAAAGAGGCTTACTCGAGTAAGCCTCTTTCACGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-215s1c1
Sequence:CCGGCAGACAAGGGACTATCAGGAACTCGAGTTCCTGATAGTCCCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-517s1c1
Sequence:CCGGCATAGCAACTGCAAAGAGCCACTCGAGTGGCTCTTTGCAGTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199297.1-409s1c1
Sequence:CCGGGATCTCAAAGCACAGCCCAAACTCGAGTTTGGGCTGTGCTTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199297.1-647s21c1
Sequence:CCGGGGTCCATGAAGAGTTTGATTTCTCGAGAAATCAAACTCTTCATGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199297.1-690s21c1
Sequence:CCGGGAACCAAGTTAACTGAGATACCTCGAGGTATCTCAGTTAACTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199297.1-370s21c1
Sequence:CCGGCGCCTAGAGAAAGGTGTAGATCTCGAGATCTACACCTTTCTCTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144543
VALIDATED
THYN1 MISSION shRNA Bacterial Glycerol Stock
thymocyte nuclear protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-561s1c1
Sequence:CCGGGCAAAGAGGACGACCCTAAATCTCGAGATTTAGGGTCGTCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-544s1c1
Sequence:CCGGCCATTACGATCCATCCAGCAACTCGAGTTGCTGGATGGATCGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-545s1c1
Sequence:CCGGCATTACGATCCATCCAGCAAACTCGAGTTTGCTGGATGGATCGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-274s21c1
Sequence:CCGGTTGAGATGACGACAACCTTTACTCGAGTAAAGGTTGTCGTCATCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-207s21c1
Sequence:CCGGCTATCCGGGAAACGTACTAAACTCGAGTTTAGTACGTTTCCCGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-527s21c1
Sequence:CCGGTGGACTTATGAAGATTGTAAACTCGAGTTTACAATCTTCATAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144543.2-779s21c1
Sequence:CCGGGACTCAAGAAGAGTTTGATTTCTCGAGAAATCAAACTCTTCTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-349s21c1
Sequence:CCGGGCCGGCTAGAGAAAGGTATAGCTCGAGCTATACCTTTCTCTAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144543
VALIDATED
THYN1 MISSION shRNA shRNA Plasmid DNA
thymocyte nuclear protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-561s1c1
Sequence:CCGGGCAAAGAGGACGACCCTAAATCTCGAGATTTAGGGTCGTCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-544s1c1
Sequence:CCGGCCATTACGATCCATCCAGCAACTCGAGTTGCTGGATGGATCGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-545s1c1
Sequence:CCGGCATTACGATCCATCCAGCAAACTCGAGTTTGCTGGATGGATCGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-274s21c1
Sequence:CCGGTTGAGATGACGACAACCTTTACTCGAGTAAAGGTTGTCGTCATCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-207s21c1
Sequence:CCGGCTATCCGGGAAACGTACTAAACTCGAGTTTAGTACGTTTCCCGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-527s21c1
Sequence:CCGGTGGACTTATGAAGATTGTAAACTCGAGTTTACAATCTTCATAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144543.2-779s21c1
Sequence:CCGGGACTCAAGAAGAGTTTGATTTCTCGAGAAATCAAACTCTTCTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-349s21c1
Sequence:CCGGGCCGGCTAGAGAAAGGTATAGCTCGAGCTATACCTTTCTCTAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144543
VALIDATED
THYN1 MISSION shRNA Lentiviral Transduction Particles
thymocyte nuclear protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-561s1c1
Sequence:CCGGGCAAAGAGGACGACCCTAAATCTCGAGATTTAGGGTCGTCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-544s1c1
Sequence:CCGGCCATTACGATCCATCCAGCAACTCGAGTTGCTGGATGGATCGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144543.1-545s1c1
Sequence:CCGGCATTACGATCCATCCAGCAAACTCGAGTTTGCTGGATGGATCGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-274s21c1
Sequence:CCGGTTGAGATGACGACAACCTTTACTCGAGTAAAGGTTGTCGTCATCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-207s21c1
Sequence:CCGGCTATCCGGGAAACGTACTAAACTCGAGTTTAGTACGTTTCCCGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-527s21c1
Sequence:CCGGTGGACTTATGAAGATTGTAAACTCGAGTTTACAATCTTCATAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144543.2-779s21c1
Sequence:CCGGGACTCAAGAAGAGTTTGATTTCTCGAGAAATCAAACTCTTCTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144543.2-349s21c1
Sequence:CCGGGCCGGCTAGAGAAAGGTATAGCTCGAGCTATACCTTTCTCTAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks