EMAIL THIS PAGE TO A FRIEND

TIA1

TIA1 cytotoxic granule-associated RNA binding protein

Synonyms: TIA-1 WDM
UniProtKB ID: P31483, Q53SS9
Gene ID:
Human(7072) Summary: The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. [provided by RefSeq, Jul 2008]
Mouse(21841) cytotoxic granule-associated RNA binding protein 1
Rat(312510) TIA1 cytotoxic granule-associated RNA binding protein
Zebrafish(793165) cytotoxic granule-associated RNA binding protein 1
domestic cat(101096055) TIA1 cytotoxic granule-associated RNA binding protein
dog(610625) TIA1 cytotoxic granule-associated RNA binding protein
chicken(771327) TIA1 cytotoxic granule-associated RNA binding protein
cow(538533) TIA1 cytotoxic granule-associated RNA binding protein
sheep(101105642) TIA1 cytotoxic granule-associated RNA binding protein
naked mole-rat(101725408) TIA1 cytotoxic granule-associated RNA binding protein
domestic guinea pig(100725919) TIA1 cytotoxic granule-associated RNA binding protein
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022037 Rosetta Predictions human pricing
NM_022173 Rosetta Predictions human pricing
NM_001012096 Rosetta Predictions rat pricing
XM_575591 Rosetta Predictions rat pricing
NM_011585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355384 predicted 860
2 SASI_Hs01_00070183 predicted 1141
3 SASI_Hs01_00070184 predicted 751
4 SASI_Hs01_00070185 predicted 1294
5 SASI_Hs01_00070186 predicted 1322
6 SASI_Hs01_00070187 predicted 1188
7 SASI_Hs01_00070188 predicted 956
8 SASI_Hs01_00070189 predicted 1126
9 SASI_Hs01_00070190 predicted 704
10 SASI_Hs01_00070191 predicted 824
11 SASI_Hs01_00070192 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355609 predicted 892
2 SASI_Hs01_00233191 predicted 1171
3 SASI_Hs01_00233192 predicted 781
4 SASI_Hs01_00233193 predicted 1332
5 SASI_Hs01_00233194 predicted 1361
6 SASI_Hs01_00233195 predicted 1227
7 SASI_Hs01_00233196 predicted 992
8 SASI_Hs01_00233197 predicted 1161
9 SASI_Hs01_00233198 predicted 729
10 SASI_Hs01_00233199 predicted 860
11 SASI_Hs01_00233200 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086101 predicted 826
2 SASI_Rn01_00086103 predicted 1104
3 SASI_Rn01_00086104 predicted 200
4 SASI_Rn01_00086105 predicted 1120
5 SASI_Rn01_00086106 predicted 371
6 SASI_Rn01_00086107 predicted 384
7 SASI_Rn01_00086108 predicted 921
8 SASI_Rn01_00086109 predicted 449
9 SASI_Rn02_00200230 predicted 934
10 SASI_Rn01_00086110 predicted 589
11 SASI_Rn01_00086102 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144223 predicted 867
2 SASI_Rn01_00144224 predicted 1140
3 SASI_Rn01_00144225 predicted 207
4 SASI_Rn01_00144226 predicted 1167
5 SASI_Rn01_00144227 predicted 958
6 SASI_Rn01_00144228 predicted 1190
7 SASI_Rn01_00144229 predicted 697
8 SASI_Rn01_00144230 predicted 791
9 SASI_Rn01_00144231 predicted 1176
10 SASI_Rn01_00144232 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051645 predicted 1170
2 SASI_Mm01_00051646 predicted 1467
3 SASI_Mm01_00051647 predicted 404
4 SASI_Mm02_00320979 predicted 1012
5 SASI_Mm01_00051648 predicted 235
6 SASI_Mm01_00051649 predicted 842
7 SASI_Mm01_00051651 predicted 298
8 SASI_Mm01_00051652 predicted 423
9 SASI_Mm02_00320980 predicted 1285
10 SASI_Mm01_00051653 predicted 659
11 SASI_Mm01_00051644 predicted 897
12 SASI_Mm01_00051650 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022173
VALIDATED
TIA1 MISSION shRNA Bacterial Glycerol Stock
TIA1 cytotoxic granule-associated RNA binding protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-514s21c1
Sequence:CCGGACAGCGTTCACAAGATCATTTCTCGAGAAATGATCTTGTGAACGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-638s21c1
Sequence:CCGGATGGCAACAGGAAAGTCTAAGCTCGAGCTTAGACTTTCCTGTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-752s21c1
Sequence:CCGGACTAACTGGGCAACCCGAAAGCTCGAGCTTTCGGGTTGCCCAGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-246s1c1
Sequence:CCGGGCTCTAATTCTGCAACTCTTTCTCGAGAAAGAGTTGCAGAATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-390s1c1
Sequence:CCGGCGGAAGATAATGGGTAAGGAACTCGAGTTCCTTACCCATTATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022173.1-378s1c1
Sequence:CCGGGCTATGAATGGACGGAAGATACTCGAGTATCTTCCGTCCATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022173.1-1144s1c1
Sequence:CCGGGCCAGTATATGCCTAATGGTTCTCGAGAACCATTAGGCATATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-1402s1c1
Sequence:CCGGGCCGTTGTTTACTTAAAGATTCTCGAGAATCTTTAAGTAAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022173
VALIDATED
TIA1 MISSION shRNA shRNA Plasmid DNA
TIA1 cytotoxic granule-associated RNA binding protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-514s21c1
Sequence:CCGGACAGCGTTCACAAGATCATTTCTCGAGAAATGATCTTGTGAACGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-638s21c1
Sequence:CCGGATGGCAACAGGAAAGTCTAAGCTCGAGCTTAGACTTTCCTGTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-752s21c1
Sequence:CCGGACTAACTGGGCAACCCGAAAGCTCGAGCTTTCGGGTTGCCCAGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-246s1c1
Sequence:CCGGGCTCTAATTCTGCAACTCTTTCTCGAGAAAGAGTTGCAGAATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-390s1c1
Sequence:CCGGCGGAAGATAATGGGTAAGGAACTCGAGTTCCTTACCCATTATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022173.1-378s1c1
Sequence:CCGGGCTATGAATGGACGGAAGATACTCGAGTATCTTCCGTCCATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022173.1-1144s1c1
Sequence:CCGGGCCAGTATATGCCTAATGGTTCTCGAGAACCATTAGGCATATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-1402s1c1
Sequence:CCGGGCCGTTGTTTACTTAAAGATTCTCGAGAATCTTTAAGTAAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022173
VALIDATED
TIA1 MISSION shRNA Lentiviral Transduction Particles
TIA1 cytotoxic granule-associated RNA binding protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-514s21c1
Sequence:CCGGACAGCGTTCACAAGATCATTTCTCGAGAAATGATCTTGTGAACGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-638s21c1
Sequence:CCGGATGGCAACAGGAAAGTCTAAGCTCGAGCTTAGACTTTCCTGTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022173.2-752s21c1
Sequence:CCGGACTAACTGGGCAACCCGAAAGCTCGAGCTTTCGGGTTGCCCAGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-246s1c1
Sequence:CCGGGCTCTAATTCTGCAACTCTTTCTCGAGAAAGAGTTGCAGAATTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-390s1c1
Sequence:CCGGCGGAAGATAATGGGTAAGGAACTCGAGTTCCTTACCCATTATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022173.1-378s1c1
Sequence:CCGGGCTATGAATGGACGGAAGATACTCGAGTATCTTCCGTCCATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022173.1-1144s1c1
Sequence:CCGGGCCAGTATATGCCTAATGGTTCTCGAGAACCATTAGGCATATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022173.1-1402s1c1
Sequence:CCGGGCCGTTGTTTACTTAAAGATTCTCGAGAATCTTTAAGTAAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011585
VALIDATED
TIA1 MISSION shRNA Bacterial Glycerol Stock
TIA1 cytotoxic granule-associated RNA binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-1009s21c1
Sequence:CCGGCATGCGATTGTTTCTGTTAATCTCGAGATTAACAGAAACAATCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-1165s21c1
Sequence:CCGGGCACAACAGATTGGCCAGTATCTCGAGATACTGGCCAATCTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011585.3-1561s21c1
Sequence:CCGGCGATGGTGGATGTTTGCCAATCTCGAGATTGGCAAACATCCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-576s21c1
Sequence:CCGGCGAAGACATCAAAGCAGCGTTCTCGAGAACGCTGCTTTGATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1559s1c1
Sequence:CCGGCGATGGTGGATGTTTGCCAATCTCGAGATTGGCAAACATCCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1165s1c1
Sequence:CCGGGCACAACAGATTGGCCAGTATCTCGAGATACTGGCCAATCTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-347s1c1
Sequence:CCGGCAGGAAATGACCCATACTGTTCTCGAGAACAGTATGGGTCATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1009s1c1
Sequence:CCGGCATGCGATTGTTTCTGTTAATCTCGAGATTAACAGAAACAATCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-576s1c1
Sequence:CCGGCGAAGACATCAAAGCAGCGTTCTCGAGAACGCTGCTTTGATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011585
VALIDATED
TIA1 MISSION shRNA shRNA Plasmid DNA
TIA1 cytotoxic granule-associated RNA binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-1009s21c1
Sequence:CCGGCATGCGATTGTTTCTGTTAATCTCGAGATTAACAGAAACAATCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-1165s21c1
Sequence:CCGGGCACAACAGATTGGCCAGTATCTCGAGATACTGGCCAATCTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011585.3-1561s21c1
Sequence:CCGGCGATGGTGGATGTTTGCCAATCTCGAGATTGGCAAACATCCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-576s21c1
Sequence:CCGGCGAAGACATCAAAGCAGCGTTCTCGAGAACGCTGCTTTGATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1559s1c1
Sequence:CCGGCGATGGTGGATGTTTGCCAATCTCGAGATTGGCAAACATCCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1165s1c1
Sequence:CCGGGCACAACAGATTGGCCAGTATCTCGAGATACTGGCCAATCTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-347s1c1
Sequence:CCGGCAGGAAATGACCCATACTGTTCTCGAGAACAGTATGGGTCATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1009s1c1
Sequence:CCGGCATGCGATTGTTTCTGTTAATCTCGAGATTAACAGAAACAATCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-576s1c1
Sequence:CCGGCGAAGACATCAAAGCAGCGTTCTCGAGAACGCTGCTTTGATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011585
VALIDATED
TIA1 MISSION shRNA Lentiviral Transduction Particles
TIA1 cytotoxic granule-associated RNA binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-1009s21c1
Sequence:CCGGCATGCGATTGTTTCTGTTAATCTCGAGATTAACAGAAACAATCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-1165s21c1
Sequence:CCGGGCACAACAGATTGGCCAGTATCTCGAGATACTGGCCAATCTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011585.3-1561s21c1
Sequence:CCGGCGATGGTGGATGTTTGCCAATCTCGAGATTGGCAAACATCCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011585.3-576s21c1
Sequence:CCGGCGAAGACATCAAAGCAGCGTTCTCGAGAACGCTGCTTTGATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1559s1c1
Sequence:CCGGCGATGGTGGATGTTTGCCAATCTCGAGATTGGCAAACATCCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1165s1c1
Sequence:CCGGGCACAACAGATTGGCCAGTATCTCGAGATACTGGCCAATCTGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-347s1c1
Sequence:CCGGCAGGAAATGACCCATACTGTTCTCGAGAACAGTATGGGTCATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-1009s1c1
Sequence:CCGGCATGCGATTGTTTCTGTTAATCTCGAGATTAACAGAAACAATCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011585.2-576s1c1
Sequence:CCGGCGAAGACATCAAAGCAGCGTTCTCGAGAACGCTGCTTTGATGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks