EMAIL THIS PAGE TO A FRIEND

TIAF1

TGFB1-induced anti-apoptotic factor 1

Synonyms: MAJN SPR210
UniProtKB ID: O95411, A2RRE2, Q6PEG2
Gene ID:
cow(101903486) TGFB1-induced anti-apoptotic factor 1
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004740 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221441 MISSION® esiRNA esiRNA targeting human TIAF1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004740 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105445 predicted 1659
2 SASI_Hs01_00105446 predicted 1659
3 SASI_Hs01_00105447 predicted 1753
4 SASI_Hs01_00105448 predicted 1626
5 SASI_Hs01_00105449 predicted 1825
6 SASI_Hs01_00105450 predicted 1615
7 SASI_Hs01_00105451 predicted 1606
8 SASI_Hs02_00338221 predicted 1444
9 SASI_Hs01_00105452 predicted 1620
10 SASI_Hs01_00105454 predicted 1647
11 SASI_Hs01_00105453 predicted 1875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004740
TIAF1 MISSION shRNA Bacterial Glycerol Stock
TGFB1-induced anti-apoptotic factor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004740.3-1798s1c1
Sequence:CCGGCGGTGCTCATTAGACATGAGTCTCGAGACTCATGTCTAATGAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1628s1c1
Sequence:CCGGGCAATGACCTATTTAAGGTAACTCGAGTTACCTTAAATAGGTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1604s1c1
Sequence:CCGGCCTCTTTGTCTCAGCGTGTTACTCGAGTAACACGCTGAGACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1483s1c1
Sequence:CCGGCGGGTCCAGGTTCTTAAGAATCTCGAGATTCTTAAGAACCTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1650s1c1
Sequence:CCGGCCCATTCCAACTACAGCAGTTCTCGAGAACTGCTGTAGTTGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004740.3-1542s21c1
Sequence:CCGGTGAGCAAGCCTACGCAGACAACTCGAGTTGTCTGCGTAGGCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004740.3-2004s21c1
Sequence:CCGGTTCTCTCCTGCAATTGGTTTGCTCGAGCAAACCAATTGCAGGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004740
TIAF1 MISSION shRNA shRNA Plasmid DNA
TGFB1-induced anti-apoptotic factor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004740.3-1798s1c1
Sequence:CCGGCGGTGCTCATTAGACATGAGTCTCGAGACTCATGTCTAATGAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1628s1c1
Sequence:CCGGGCAATGACCTATTTAAGGTAACTCGAGTTACCTTAAATAGGTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1604s1c1
Sequence:CCGGCCTCTTTGTCTCAGCGTGTTACTCGAGTAACACGCTGAGACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1483s1c1
Sequence:CCGGCGGGTCCAGGTTCTTAAGAATCTCGAGATTCTTAAGAACCTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1650s1c1
Sequence:CCGGCCCATTCCAACTACAGCAGTTCTCGAGAACTGCTGTAGTTGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004740.3-1542s21c1
Sequence:CCGGTGAGCAAGCCTACGCAGACAACTCGAGTTGTCTGCGTAGGCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004740.3-2004s21c1
Sequence:CCGGTTCTCTCCTGCAATTGGTTTGCTCGAGCAAACCAATTGCAGGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004740
TIAF1 MISSION shRNA Lentiviral Transduction Particles
TGFB1-induced anti-apoptotic factor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004740.3-1798s1c1
Sequence:CCGGCGGTGCTCATTAGACATGAGTCTCGAGACTCATGTCTAATGAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1628s1c1
Sequence:CCGGGCAATGACCTATTTAAGGTAACTCGAGTTACCTTAAATAGGTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1604s1c1
Sequence:CCGGCCTCTTTGTCTCAGCGTGTTACTCGAGTAACACGCTGAGACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1483s1c1
Sequence:CCGGCGGGTCCAGGTTCTTAAGAATCTCGAGATTCTTAAGAACCTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004740.3-1650s1c1
Sequence:CCGGCCCATTCCAACTACAGCAGTTCTCGAGAACTGCTGTAGTTGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004740.3-1542s21c1
Sequence:CCGGTGAGCAAGCCTACGCAGACAACTCGAGTTGTCTGCGTAGGCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004740.3-2004s21c1
Sequence:CCGGTTCTCTCCTGCAATTGGTTTGCTCGAGCAAACCAATTGCAGGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks