EMAIL THIS PAGE TO A FRIEND

TIAL1

TIA1 cytotoxic granule-associated RNA binding protein-like 1

Synonyms: TCBP TIAR
UniProtKB ID: Q01085, A8K3T0, A8K4L9
Gene ID:
Human(7073) Summary: The protein encoded by this gene is a member of a family of RNA-binding proteins, has three RNA recognition motifs (RRMs), and binds adenine and uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes. It regulates various activities including translational control, splicing and apoptosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The different isoforms have been show to function differently with respect to post-transcriptional silencing. [provided by RefSeq, Jul 2008]
Mouse(21843) Tia1 cytotoxic granule-associated RNA binding protein-like 1
Rat(361655) Tia1 cytotoxic granule-associated RNA binding protein-like 1
cow(614540) TIA1 cytotoxic granule-associated RNA binding protein-like 1
sheep(101107918) TIA1 cytotoxic granule-associated RNA binding protein-like 1
domestic guinea pig(100718733) TIA1 cytotoxic granule-associated RNA binding protein-like 1
naked mole-rat(101709671) TIA1 cytotoxic granule-associated RNA binding protein-like 1
Zebrafish(394107) TIA1 cytotoxic granule-associated RNA binding protein-like 1
dog(477841) TIA1 cytotoxic granule-associated RNA binding protein-like 1
domestic cat(101089549) TIA1 cytotoxic granule-associated RNA binding protein-like 1
Horse(100058604) TIA1 cytotoxic granule-associated RNA binding protein-like 1
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501633 Anti-TIAL1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse, bovine
ELISA, immunohistochemistry, western blot pricing
SAB1409738 Anti-TIAL1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AV02048 Anti-TIAL1 antibody produced in rabbit IgG fraction of antiserum rabbit, mouse, rat, human, zebrafish, horse, canine, bovine, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003252 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033925 Rosetta Predictions human pricing
NM_003252 Rosetta Predictions human pricing
NM_001013193 Rosetta Predictions rat pricing
NM_009383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044286 predicted 1121
2 SASI_Hs01_00044287 predicted 1202
3 SASI_Hs01_00044288 predicted 1175
4 SASI_Hs01_00044289 predicted 1255
5 SASI_Hs01_00044290 predicted 2138
6 SASI_Hs01_00044291 predicted 1525
7 SASI_Hs01_00044292 predicted 1184
8 SASI_Hs01_00044293 predicted 996
9 SASI_Hs01_00044294 predicted 1327
10 SASI_Hs01_00044295 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111458 predicted 1068
2 SASI_Hs01_00111459 predicted 1144
3 SASI_Hs01_00111460 predicted 1126
4 SASI_Hs01_00111461 predicted 1207
5 SASI_Hs01_00111462 predicted 2081
6 SASI_Hs01_00111463 predicted 1475
7 SASI_Hs01_00111464 predicted 1135
8 SASI_Hs01_00111465 predicted 945
9 SASI_Hs01_00111466 predicted 1283
10 SASI_Hs01_00111467 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070253 predicted 1245
2 SASI_Rn01_00070254 predicted 636
3 SASI_Rn01_00070255 predicted 972
4 SASI_Rn01_00070256 predicted 814
5 SASI_Rn01_00070257 predicted 1234
6 SASI_Rn01_00070258 predicted 1006
7 SASI_Rn01_00070259 predicted 449
8 SASI_Rn01_00070260 predicted 904
9 SASI_Rn01_00070261 predicted 387
10 SASI_Rn02_00200956 predicted 633
11 SASI_Rn01_00070262 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164171 predicted 688
2 SASI_Mm01_00164172 predicted 1382
3 SASI_Mm01_00164173 predicted 1123
4 SASI_Mm01_00164174 predicted 1113
5 SASI_Mm01_00164175 predicted 969
6 SASI_Mm01_00164176 predicted 1347
7 SASI_Mm01_00164177 predicted 1320
8 SASI_Mm01_00164178 predicted 971
9 SASI_Mm01_00164179 predicted 1055
10 SASI_Mm01_00164180 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009383
VALIDATED
TIAL1 MISSION shRNA Bacterial Glycerol Stock
TIA1 cytotoxic granule-associated RNA binding protein-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-1355s21c1
Sequence:CCGGTACCACCCTATGGAGTATATGCTCGAGCATATACTCCATAGGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009383.2-953s21c1
Sequence:CCGGGTACACAAGAAACTAACACTACTCGAGTAGTGTTAGTTTCTTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-1582s21c1
Sequence:CCGGCCTGTCACACTCTGAAGACATCTCGAGATGTCTTCAGAGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-537s21c1
Sequence:CCGGGCATACAAGCAATGACCCATACTCGAGTATGGGTCATTGCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-1358s1c1
Sequence:CCGGCCTGTCACACTCTGAAGACATCTCGAGATGTCTTCAGAGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-1090s1c1
Sequence:CCGGCCCACAACAGTATGGACAGTACTCGAGTACTGTCCATACTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009383.1-1252s1c1
Sequence:CCGGCCCTGTAATACCTCCTCCAAACTCGAGTTTGGAGGAGGTATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-729s1c1
Sequence:CCGGGTACACAAGAAACTAACACTACTCGAGTAGTGTTAGTTTCTTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-313s1c1
Sequence:CCGGGCATACAAGCAATGACCCATACTCGAGTATGGGTCATTGCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009383
VALIDATED
TIAL1 MISSION shRNA shRNA Plasmid DNA
TIA1 cytotoxic granule-associated RNA binding protein-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-1355s21c1
Sequence:CCGGTACCACCCTATGGAGTATATGCTCGAGCATATACTCCATAGGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009383.2-953s21c1
Sequence:CCGGGTACACAAGAAACTAACACTACTCGAGTAGTGTTAGTTTCTTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-1582s21c1
Sequence:CCGGCCTGTCACACTCTGAAGACATCTCGAGATGTCTTCAGAGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-537s21c1
Sequence:CCGGGCATACAAGCAATGACCCATACTCGAGTATGGGTCATTGCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-1358s1c1
Sequence:CCGGCCTGTCACACTCTGAAGACATCTCGAGATGTCTTCAGAGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-1090s1c1
Sequence:CCGGCCCACAACAGTATGGACAGTACTCGAGTACTGTCCATACTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009383.1-1252s1c1
Sequence:CCGGCCCTGTAATACCTCCTCCAAACTCGAGTTTGGAGGAGGTATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-729s1c1
Sequence:CCGGGTACACAAGAAACTAACACTACTCGAGTAGTGTTAGTTTCTTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-313s1c1
Sequence:CCGGGCATACAAGCAATGACCCATACTCGAGTATGGGTCATTGCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009383
VALIDATED
TIAL1 MISSION shRNA Lentiviral Transduction Particles
TIA1 cytotoxic granule-associated RNA binding protein-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-1355s21c1
Sequence:CCGGTACCACCCTATGGAGTATATGCTCGAGCATATACTCCATAGGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009383.2-953s21c1
Sequence:CCGGGTACACAAGAAACTAACACTACTCGAGTAGTGTTAGTTTCTTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-1582s21c1
Sequence:CCGGCCTGTCACACTCTGAAGACATCTCGAGATGTCTTCAGAGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009383.2-537s21c1
Sequence:CCGGGCATACAAGCAATGACCCATACTCGAGTATGGGTCATTGCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-1358s1c1
Sequence:CCGGCCTGTCACACTCTGAAGACATCTCGAGATGTCTTCAGAGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-1090s1c1
Sequence:CCGGCCCACAACAGTATGGACAGTACTCGAGTACTGTCCATACTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009383.1-1252s1c1
Sequence:CCGGCCCTGTAATACCTCCTCCAAACTCGAGTTTGGAGGAGGTATTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-729s1c1
Sequence:CCGGGTACACAAGAAACTAACACTACTCGAGTAGTGTTAGTTTCTTGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009383.1-313s1c1
Sequence:CCGGGCATACAAGCAATGACCCATACTCGAGTATGGGTCATTGCTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003252
VALIDATED
TIAL1 MISSION shRNA Bacterial Glycerol Stock
TIA1 cytotoxic granule-associated RNA binding protein-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-1471s21c1
Sequence:CCGGCCACAACAGTATGGACAGTATCTCGAGATACTGTCCATACTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-640s21c1
Sequence:CCGGCTTCAGTTGTTCAGTCAGATTCTCGAGAATCTGACTGAACAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-708s21c1
Sequence:CCGGCCCATATTGCTTTGTGGAATTCTCGAGAATTCCACAAAGCAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-1718s21c1
Sequence:CCGGATTCATGATAGGCTTCGATTTCTCGAGAAATCGAAGCCTATCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003252.2-1113s1c1
Sequence:CCGGCCCTGTAATACCTCCTCCTAACTCGAGTTAGGAGGAGGTATTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-189s1c1
Sequence:CCGGCCCATATTGCTTTGTGGAATTCTCGAGAATTCCACAAAGCAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-952s1c1
Sequence:CCGGCCACAACAGTATGGACAGTATCTCGAGATACTGTCCATACTGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-121s1c1
Sequence:CCGGCTTCAGTTGTTCAGTCAGATTCTCGAGAATCTGACTGAACAACTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-1140s1c1
Sequence:CCGGCGGATATGGTATGGCAAGTTACTCGAGTAACTTGCCATACCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003252
VALIDATED
TIAL1 MISSION shRNA shRNA Plasmid DNA
TIA1 cytotoxic granule-associated RNA binding protein-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-1471s21c1
Sequence:CCGGCCACAACAGTATGGACAGTATCTCGAGATACTGTCCATACTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-640s21c1
Sequence:CCGGCTTCAGTTGTTCAGTCAGATTCTCGAGAATCTGACTGAACAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-708s21c1
Sequence:CCGGCCCATATTGCTTTGTGGAATTCTCGAGAATTCCACAAAGCAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-1718s21c1
Sequence:CCGGATTCATGATAGGCTTCGATTTCTCGAGAAATCGAAGCCTATCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003252.2-1113s1c1
Sequence:CCGGCCCTGTAATACCTCCTCCTAACTCGAGTTAGGAGGAGGTATTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-189s1c1
Sequence:CCGGCCCATATTGCTTTGTGGAATTCTCGAGAATTCCACAAAGCAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-952s1c1
Sequence:CCGGCCACAACAGTATGGACAGTATCTCGAGATACTGTCCATACTGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-121s1c1
Sequence:CCGGCTTCAGTTGTTCAGTCAGATTCTCGAGAATCTGACTGAACAACTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-1140s1c1
Sequence:CCGGCGGATATGGTATGGCAAGTTACTCGAGTAACTTGCCATACCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003252
VALIDATED
TIAL1 MISSION shRNA Lentiviral Transduction Particles
TIA1 cytotoxic granule-associated RNA binding protein-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-1471s21c1
Sequence:CCGGCCACAACAGTATGGACAGTATCTCGAGATACTGTCCATACTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-640s21c1
Sequence:CCGGCTTCAGTTGTTCAGTCAGATTCTCGAGAATCTGACTGAACAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-708s21c1
Sequence:CCGGCCCATATTGCTTTGTGGAATTCTCGAGAATTCCACAAAGCAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003252.3-1718s21c1
Sequence:CCGGATTCATGATAGGCTTCGATTTCTCGAGAAATCGAAGCCTATCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003252.2-1113s1c1
Sequence:CCGGCCCTGTAATACCTCCTCCTAACTCGAGTTAGGAGGAGGTATTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-189s1c1
Sequence:CCGGCCCATATTGCTTTGTGGAATTCTCGAGAATTCCACAAAGCAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-952s1c1
Sequence:CCGGCCACAACAGTATGGACAGTATCTCGAGATACTGTCCATACTGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-121s1c1
Sequence:CCGGCTTCAGTTGTTCAGTCAGATTCTCGAGAATCTGACTGAACAACTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003252.2-1140s1c1
Sequence:CCGGCGGATATGGTATGGCAAGTTACTCGAGTAACTTGCCATACCATATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks