EMAIL THIS PAGE TO A FRIEND

TIAM1

T-cell lymphoma invasion and metastasis 1

UniProtKB ID: Q13009, Q17RT7
Gene ID:
Mouse(21844) T cell lymphoma invasion and metastasis 1
Rat(304109) T-cell lymphoma invasion and metastasis 1
chicken(418491) T-cell lymphoma invasion and metastasis 1
Horse(100052764) T-cell lymphoma invasion and metastasis 1
domestic cat(101094530) T-cell lymphoma invasion and metastasis 1
dog(487731) T-cell lymphoma invasion and metastasis 1
naked mole-rat(101711984) T-cell lymphoma invasion and metastasis 1
Domestic Rabbit(100338333) T-cell lymphoma invasion and metastasis 1
domestic guinea pig(100735633) T-cell lymphoma invasion and metastasis 1
cow(536517) T-cell lymphoma invasion and metastasis 1
sheep(101103280) T-cell lymphoma invasion and metastasis 1
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305952 ANTI-TIAM1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003253 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021521 MISSION® esiRNA esiRNA targeting mouse Tiam1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003253 Rosetta Predictions human pricing
XM_001072877 Rosetta Predictions rat pricing
XM_221672 Rosetta Predictions rat pricing
NM_009384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139463 predicted 774
2 SASI_Hs01_00139464 predicted 4641
3 SASI_Hs01_00139465 predicted 3059
4 SASI_Hs01_00139466 predicted 4331
5 SASI_Hs01_00139468 predicted 2740
6 SASI_Hs01_00139470 predicted 4818
7 SASI_Hs01_00139471 predicted 4623
8 SASI_Hs01_00139472 predicted 5099
9 SASI_Hs02_00335295 predicted 3661
10 SASI_Hs02_00335296 predicted 4657
11 SASI_Hs01_00139467 predicted 1245
12 SASI_Hs01_00139469 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340743 predicted 3772
2 SASI_Rn02_00340744 predicted 3182
3 SASI_Rn02_00340745 predicted 3117
4 SASI_Rn02_00340746 predicted 5371
5 SASI_Rn02_00340747 predicted 4208
6 SASI_Rn02_00340748 predicted 3232
7 SASI_Rn02_00340749 predicted 1280
8 SASI_Rn02_00340750 predicted 4866
9 SASI_Rn02_00340751 predicted 1419
10 SASI_Rn02_00340752 predicted 3662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380301 predicted 4071
2 SASI_Rn02_00380302 predicted 3485
3 SASI_Rn02_00380303 predicted 3409
4 SASI_Rn02_00380304 predicted 5665
5 SASI_Rn02_00380305 predicted 4503
6 SASI_Rn02_00380306 predicted 3523
7 SASI_Rn02_00380307 predicted 1582
8 SASI_Rn02_00380308 predicted 5162
9 SASI_Rn02_00380309 predicted 1718
10 SASI_Rn02_00380310 predicted 3960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020106 predicted 2768
2 SASI_Mm01_00020107 predicted 3767
3 SASI_Mm01_00020108 predicted 3658
4 SASI_Mm01_00020109 predicted 1266
5 SASI_Mm01_00020110 predicted 4567
6 SASI_Mm01_00020111 predicted 4363
7 SASI_Mm01_00020112 predicted 3495
8 SASI_Mm01_00020113 predicted 1409
9 SASI_Mm01_00020114 predicted 2673
10 SASI_Mm01_00020115 predicted 5004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003253
VALIDATED
TIAM1 MISSION shRNA Bacterial Glycerol Stock
T-cell lymphoma invasion and metastasis 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003253.x-5280s1c1
Sequence:CCGGTAGATACTTCCTGCCCTAACTCTCGAGAGTTAGGGCAGGAAGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.x-918s1c1
Sequence:CCGGCAGCATTCCTATACATCCAATCTCGAGATTGGATGTATAGGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.x-4965s1c1
Sequence:CCGGACATCAAGGAGACAGACATCCTCGAGGATGTCTGTCTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.1-1245s1c1
Sequence:CCGGCGGAATTTGGTGTCTGATATTCTCGAGAATATCAGACACCAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3814s21c1
Sequence:CCGGGCTTGAGAAGGTTGATCAATTCTCGAGAATTGATCAACCTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3151s21c1
Sequence:CCGGTGAGATTCTTGAGATCAATAACTCGAGTTATTGATCTCAAGAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003253.2-2727s21c1
Sequence:CCGGACAACCCTGACTGCGACATTTCTCGAGAAATGTCGCAGTCAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003253.2-6656s21c1
Sequence:CCGGTAGTAGCTTTAGGAGTTATATCTCGAGATATAACTCCTAAAGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3081s21c1
Sequence:CCGGTTCGAAGGCTGTACGTGAATACTCGAGTATTCACGTACAGCCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003253
VALIDATED
TIAM1 MISSION shRNA shRNA Plasmid DNA
T-cell lymphoma invasion and metastasis 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003253.x-5280s1c1
Sequence:CCGGTAGATACTTCCTGCCCTAACTCTCGAGAGTTAGGGCAGGAAGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.x-918s1c1
Sequence:CCGGCAGCATTCCTATACATCCAATCTCGAGATTGGATGTATAGGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.x-4965s1c1
Sequence:CCGGACATCAAGGAGACAGACATCCTCGAGGATGTCTGTCTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.1-1245s1c1
Sequence:CCGGCGGAATTTGGTGTCTGATATTCTCGAGAATATCAGACACCAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3814s21c1
Sequence:CCGGGCTTGAGAAGGTTGATCAATTCTCGAGAATTGATCAACCTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3151s21c1
Sequence:CCGGTGAGATTCTTGAGATCAATAACTCGAGTTATTGATCTCAAGAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003253.2-2727s21c1
Sequence:CCGGACAACCCTGACTGCGACATTTCTCGAGAAATGTCGCAGTCAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003253.2-6656s21c1
Sequence:CCGGTAGTAGCTTTAGGAGTTATATCTCGAGATATAACTCCTAAAGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3081s21c1
Sequence:CCGGTTCGAAGGCTGTACGTGAATACTCGAGTATTCACGTACAGCCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003253
VALIDATED
TIAM1 MISSION shRNA Lentiviral Transduction Particles
T-cell lymphoma invasion and metastasis 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003253.x-5280s1c1
Sequence:CCGGTAGATACTTCCTGCCCTAACTCTCGAGAGTTAGGGCAGGAAGTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.x-918s1c1
Sequence:CCGGCAGCATTCCTATACATCCAATCTCGAGATTGGATGTATAGGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.x-4965s1c1
Sequence:CCGGACATCAAGGAGACAGACATCCTCGAGGATGTCTGTCTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003253.1-1245s1c1
Sequence:CCGGCGGAATTTGGTGTCTGATATTCTCGAGAATATCAGACACCAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3814s21c1
Sequence:CCGGGCTTGAGAAGGTTGATCAATTCTCGAGAATTGATCAACCTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3151s21c1
Sequence:CCGGTGAGATTCTTGAGATCAATAACTCGAGTTATTGATCTCAAGAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003253.2-2727s21c1
Sequence:CCGGACAACCCTGACTGCGACATTTCTCGAGAAATGTCGCAGTCAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003253.2-6656s21c1
Sequence:CCGGTAGTAGCTTTAGGAGTTATATCTCGAGATATAACTCCTAAAGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003253.2-3081s21c1
Sequence:CCGGTTCGAAGGCTGTACGTGAATACTCGAGTATTCACGTACAGCCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009384
VALIDATED
TIAM1 MISSION shRNA Bacterial Glycerol Stock
T-cell lymphoma invasion and metastasis 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-2634s1c1
Sequence:CCGGCCAACCATCAACCAGGTGTTTCTCGAGAAACACCTGGTTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009384.1-1278s1c1
Sequence:CCGGCGGAATTTGGTGTCGGATATTCTCGAGAATATCCGACACCAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-4762s1c1
Sequence:CCGGGCAAGAGATTGTGTGCGCTTACTCGAGTAAGCGCACACAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-1415s1c1
Sequence:CCGGCCCACAAATTAGCCTTAGCAACTCGAGTTGCTAAGGCTAATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-3066s1c1
Sequence:CCGGGCCGCTGATAATTACGGGTTTCTCGAGAAACCCGTAATTATCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009384.3-4570s21c1
Sequence:CCGGGCGAAATTGTCCACGTGAAATCTCGAGATTTCACGTGGACAATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009384.3-4674s21c1
Sequence:CCGGCATTCGATCCTGCGAGATAAACTCGAGTTTATCTCGCAGGATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009384.3-770s21c1
Sequence:CCGGCTGGGTGGACCGAGTAGATATCTCGAGATATCTACTCGGTCCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009384.3-1262s21c1
Sequence:CCGGCTCAAGCTACTGCCGGAATTTCTCGAGAAATTCCGGCAGTAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009384.3-5764s21c1
Sequence:CCGGCCTCTTCAGCGTCCGAGAATACTCGAGTATTCTCGGACGCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009384
VALIDATED
TIAM1 MISSION shRNA shRNA Plasmid DNA
T-cell lymphoma invasion and metastasis 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-2634s1c1
Sequence:CCGGCCAACCATCAACCAGGTGTTTCTCGAGAAACACCTGGTTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009384.1-1278s1c1
Sequence:CCGGCGGAATTTGGTGTCGGATATTCTCGAGAATATCCGACACCAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-4762s1c1
Sequence:CCGGGCAAGAGATTGTGTGCGCTTACTCGAGTAAGCGCACACAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-1415s1c1
Sequence:CCGGCCCACAAATTAGCCTTAGCAACTCGAGTTGCTAAGGCTAATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-3066s1c1
Sequence:CCGGGCCGCTGATAATTACGGGTTTCTCGAGAAACCCGTAATTATCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009384.3-4570s21c1
Sequence:CCGGGCGAAATTGTCCACGTGAAATCTCGAGATTTCACGTGGACAATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009384.3-4674s21c1
Sequence:CCGGCATTCGATCCTGCGAGATAAACTCGAGTTTATCTCGCAGGATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009384.3-770s21c1
Sequence:CCGGCTGGGTGGACCGAGTAGATATCTCGAGATATCTACTCGGTCCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009384.3-1262s21c1
Sequence:CCGGCTCAAGCTACTGCCGGAATTTCTCGAGAAATTCCGGCAGTAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009384.3-5764s21c1
Sequence:CCGGCCTCTTCAGCGTCCGAGAATACTCGAGTATTCTCGGACGCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009384
VALIDATED
TIAM1 MISSION shRNA Lentiviral Transduction Particles
T-cell lymphoma invasion and metastasis 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-2634s1c1
Sequence:CCGGCCAACCATCAACCAGGTGTTTCTCGAGAAACACCTGGTTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009384.1-1278s1c1
Sequence:CCGGCGGAATTTGGTGTCGGATATTCTCGAGAATATCCGACACCAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-4762s1c1
Sequence:CCGGGCAAGAGATTGTGTGCGCTTACTCGAGTAAGCGCACACAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-1415s1c1
Sequence:CCGGCCCACAAATTAGCCTTAGCAACTCGAGTTGCTAAGGCTAATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009384.1-3066s1c1
Sequence:CCGGGCCGCTGATAATTACGGGTTTCTCGAGAAACCCGTAATTATCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009384.3-4570s21c1
Sequence:CCGGGCGAAATTGTCCACGTGAAATCTCGAGATTTCACGTGGACAATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009384.3-4674s21c1
Sequence:CCGGCATTCGATCCTGCGAGATAAACTCGAGTTTATCTCGCAGGATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009384.3-770s21c1
Sequence:CCGGCTGGGTGGACCGAGTAGATATCTCGAGATATCTACTCGGTCCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009384.3-1262s21c1
Sequence:CCGGCTCAAGCTACTGCCGGAATTTCTCGAGAAATTCCGGCAGTAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009384.3-5764s21c1
Sequence:CCGGCCTCTTCAGCGTCCGAGAATACTCGAGTATTCTCGGACGCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks