EMAIL THIS PAGE TO A FRIEND

TIAM2

T-cell lymphoma invasion and metastasis 2

Synonyms: STEF TIAM-2
Gene ID:
Human(26230) Summary: This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(24001) T cell lymphoma invasion and metastasis 2
Rat(308142) T-cell lymphoma invasion and metastasis 2
Zebrafish(100334442) T-cell lymphoma invasion and metastasis 2
chicken(421648) T-cell lymphoma invasion and metastasis 2
domestic cat(101085127) T-cell lymphoma invasion and metastasis 2
dog(484045) T-cell lymphoma invasion and metastasis 2
Horse(100061522) T-cell lymphoma invasion and metastasis 2
cow(100139161) T-cell lymphoma invasion and metastasis 2
sheep(101105923) T-cell lymphoma invasion and metastasis 2
domestic guinea pig(100714296) T-cell lymphoma invasion and metastasis 2
naked mole-rat(101708471) T-cell lymphoma invasion and metastasis 2
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010927 Rosetta Predictions human pricing
NM_012454 Rosetta Predictions human pricing
XM_217851 Rosetta Predictions rat pricing
NM_001122998 Rosetta Predictions mouse pricing
NM_011878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305920 predicted 1309
2 SASI_Hs01_00111218 predicted 1337
3 SASI_Hs01_00111220 predicted 1302
4 SASI_Hs01_00111221 predicted 1709
5 SASI_Hs01_00111222 predicted 1302
6 SASI_Hs01_00111224 predicted 463
7 SASI_Hs01_00111225 predicted 443
8 SASI_Hs02_00305921 predicted 805
9 SASI_Hs01_00111226 predicted 566
10 SASI_Hs02_00305922 predicted 1112
11 SASI_Hs01_00111219 predicted 625
12 SASI_Hs01_00111223 predicted 1433
13 SASI_Hs01_00111227 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344363 predicted 4553
2 SASI_Hs01_00180387 predicted 4589
3 SASI_Hs01_00180389 predicted 4547
4 SASI_Hs01_00180390 predicted 4952
5 SASI_Hs01_00180391 predicted 4558
6 SASI_Hs01_00180393 predicted 3711
7 SASI_Hs01_00180394 predicted 3693
8 SASI_Hs02_00344364 predicted 4049
9 SASI_Hs01_00180395 predicted 3812
10 SASI_Hs02_00344365 predicted 4364
11 SASI_Hs01_00180388 predicted 3864
12 SASI_Hs01_00180392 predicted 4673
13 SASI_Hs01_00180396 predicted 4616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162146 predicted 1316
2 SASI_Rn01_00162147 predicted 904
3 SASI_Rn01_00162148 predicted 564
4 SASI_Rn01_00162149 predicted 316
5 SASI_Rn01_00162150 predicted 2278
6 SASI_Rn01_00162151 predicted 1683
7 SASI_Rn01_00162152 predicted 1786
8 SASI_Rn01_00162153 predicted 429
9 SASI_Rn01_00162154 predicted 260
10 SASI_Rn01_00162155 predicted 2102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309769 predicted 3959
2 SASI_Mm02_00309770 predicted 358
3 SASI_Mm02_00309771 predicted 5481
4 SASI_Mm02_00309772 predicted 1547
5 SASI_Mm02_00309773 predicted 4427
6 SASI_Mm02_00309774 predicted 1585
7 SASI_Mm02_00309775 predicted 3084
8 SASI_Mm02_00309776 predicted 1052
9 SASI_Mm02_00309777 predicted 1527
10 SASI_Mm02_00309778 predicted 2064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050811 predicted 3943
2 SASI_Mm01_00050812 predicted 340
3 SASI_Mm01_00050813 predicted 5463
4 SASI_Mm01_00050815 predicted 1537
5 SASI_Mm01_00050816 predicted 4409
6 SASI_Mm01_00050817 predicted 1567
7 SASI_Mm02_00321669 predicted 3068
8 SASI_Mm01_00050819 predicted 1028
9 SASI_Mm01_00050820 predicted 1516
10 SASI_Mm02_00321670 predicted 2047
11 SASI_Mm01_00050814 predicted 5034
12 SASI_Mm01_00050818 predicted 2908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012454
TIAM2 MISSION shRNA Bacterial Glycerol Stock
T-cell lymphoma invasion and metastasis 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012454.3-4547s21c1
Sequence:CCGGGTTAAGGTGATTCGTTCTATTCTCGAGAATAGAACGAATCACCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-309s1c1
Sequence:CCGGCCTTTCTCACTTTAAGAGTAACTCGAGTTACTCTTAAAGTGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-4865s1c1
Sequence:CCGGGCCCTACTAAAGACATCGAAACTCGAGTTTCGATGTCTTTAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-3690s1c1
Sequence:CCGGCCTTTATTACGCGGACCACTTCTCGAGAAGTGGTCCGCGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-5090s1c1
Sequence:CCGGCCCTTGACAGTCAGTCTGAAACTCGAGTTTCAGACTGACTGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-3499s1c1
Sequence:CCGGCCACTTCAGAATGAGACCTTTCTCGAGAAAGGTCTCATTCTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012454
TIAM2 MISSION shRNA shRNA Plasmid DNA
T-cell lymphoma invasion and metastasis 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012454.3-4547s21c1
Sequence:CCGGGTTAAGGTGATTCGTTCTATTCTCGAGAATAGAACGAATCACCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-309s1c1
Sequence:CCGGCCTTTCTCACTTTAAGAGTAACTCGAGTTACTCTTAAAGTGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-4865s1c1
Sequence:CCGGGCCCTACTAAAGACATCGAAACTCGAGTTTCGATGTCTTTAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-3690s1c1
Sequence:CCGGCCTTTATTACGCGGACCACTTCTCGAGAAGTGGTCCGCGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-5090s1c1
Sequence:CCGGCCCTTGACAGTCAGTCTGAAACTCGAGTTTCAGACTGACTGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-3499s1c1
Sequence:CCGGCCACTTCAGAATGAGACCTTTCTCGAGAAAGGTCTCATTCTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012454
TIAM2 MISSION shRNA Lentiviral Transduction Particles
T-cell lymphoma invasion and metastasis 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012454.3-4547s21c1
Sequence:CCGGGTTAAGGTGATTCGTTCTATTCTCGAGAATAGAACGAATCACCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-309s1c1
Sequence:CCGGCCTTTCTCACTTTAAGAGTAACTCGAGTTACTCTTAAAGTGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-4865s1c1
Sequence:CCGGGCCCTACTAAAGACATCGAAACTCGAGTTTCGATGTCTTTAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-3690s1c1
Sequence:CCGGCCTTTATTACGCGGACCACTTCTCGAGAAGTGGTCCGCGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-5090s1c1
Sequence:CCGGCCCTTGACAGTCAGTCTGAAACTCGAGTTTCAGACTGACTGTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012454.2-3499s1c1
Sequence:CCGGCCACTTCAGAATGAGACCTTTCTCGAGAAAGGTCTCATTCTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011878
VALIDATED
TIAM2 MISSION shRNA Bacterial Glycerol Stock
T-cell lymphoma invasion and metastasis 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-3114s21c1
Sequence:GTACCGGAGCATCTCAACCGGATATTTACTCGAGTAAATATCCGGTTGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-2933s21c1
Sequence:CCGGCTCCGAAAGGTGGTCGATAAACTCGAGTTTATCGACCACCTTTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-3867s21c1
Sequence:CCGGTCTCCGCTTCCTCGGACTTTACTCGAGTAAAGTCCGAGGAAGCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-344s21c1
Sequence:CCGGGGATCCAAGAATCATAGTAATCTCGAGATTACTATGATTCTTGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011878.2-5467s21c1
Sequence:CCGGGTGTGCTTACAATGCTCATTTCTCGAGAAATGAGCATTGTAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-812s1c1
Sequence:CCGGCGGGTGTTTAAGAGTCGAGTTCTCGAGAACTCGACTCTTAAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-1416s1c1
Sequence:CCGGGCTAAGAAAGACACCCTCAAACTCGAGTTTGAGGGTGTCTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-3429s1c1
Sequence:CCGGGCCACGAGTGATTTCAGCAATCTCGAGATTGCTGAAATCACTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011878.1-5903s1c1
Sequence:CCGGGCTTGGGAAAGTTGTGATTAACTCGAGTTAATCACAACTTTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-1668s1c1
Sequence:CCGGCGACAGAACATCTATGAGAATCTCGAGATTCTCATAGATGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011878
VALIDATED
TIAM2 MISSION shRNA shRNA Plasmid DNA
T-cell lymphoma invasion and metastasis 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-3114s21c1
Sequence:GTACCGGAGCATCTCAACCGGATATTTACTCGAGTAAATATCCGGTTGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-2933s21c1
Sequence:CCGGCTCCGAAAGGTGGTCGATAAACTCGAGTTTATCGACCACCTTTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-3867s21c1
Sequence:CCGGTCTCCGCTTCCTCGGACTTTACTCGAGTAAAGTCCGAGGAAGCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-344s21c1
Sequence:CCGGGGATCCAAGAATCATAGTAATCTCGAGATTACTATGATTCTTGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011878.2-5467s21c1
Sequence:CCGGGTGTGCTTACAATGCTCATTTCTCGAGAAATGAGCATTGTAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-812s1c1
Sequence:CCGGCGGGTGTTTAAGAGTCGAGTTCTCGAGAACTCGACTCTTAAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-1416s1c1
Sequence:CCGGGCTAAGAAAGACACCCTCAAACTCGAGTTTGAGGGTGTCTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-3429s1c1
Sequence:CCGGGCCACGAGTGATTTCAGCAATCTCGAGATTGCTGAAATCACTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011878.1-5903s1c1
Sequence:CCGGGCTTGGGAAAGTTGTGATTAACTCGAGTTAATCACAACTTTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-1668s1c1
Sequence:CCGGCGACAGAACATCTATGAGAATCTCGAGATTCTCATAGATGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011878
VALIDATED
TIAM2 MISSION shRNA Lentiviral Transduction Particles
T-cell lymphoma invasion and metastasis 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-3114s21c1
Sequence:GTACCGGAGCATCTCAACCGGATATTTACTCGAGTAAATATCCGGTTGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-2933s21c1
Sequence:CCGGCTCCGAAAGGTGGTCGATAAACTCGAGTTTATCGACCACCTTTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-3867s21c1
Sequence:CCGGTCTCCGCTTCCTCGGACTTTACTCGAGTAAAGTCCGAGGAAGCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011878.2-344s21c1
Sequence:CCGGGGATCCAAGAATCATAGTAATCTCGAGATTACTATGATTCTTGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011878.2-5467s21c1
Sequence:CCGGGTGTGCTTACAATGCTCATTTCTCGAGAAATGAGCATTGTAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-812s1c1
Sequence:CCGGCGGGTGTTTAAGAGTCGAGTTCTCGAGAACTCGACTCTTAAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-1416s1c1
Sequence:CCGGGCTAAGAAAGACACCCTCAAACTCGAGTTTGAGGGTGTCTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-3429s1c1
Sequence:CCGGGCCACGAGTGATTTCAGCAATCTCGAGATTGCTGAAATCACTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011878.1-5903s1c1
Sequence:CCGGGCTTGGGAAAGTTGTGATTAACTCGAGTTAATCACAACTTTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011878.1-1668s1c1
Sequence:CCGGCGACAGAACATCTATGAGAATCTCGAGATTCTCATAGATGTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks