EMAIL THIS PAGE TO A FRIEND

TICAM1

toll-like receptor adaptor molecule 1

Synonyms: IIAE6 MyD88-3 PRVTIRB TICAM-1 TRIF
UniProtKB ID: Q8IUC6, B3Y691, O75532, Q86XP8, Q96GA0
Gene ID:
Human(148022) Summary: This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
Mouse(106759) toll-like receptor adaptor molecule 1
Rat(363328) toll-like receptor adaptor molecule 1
Zebrafish(403147) toll-like receptor adaptor molecule 1
chicken(100008585) toll-like receptor adaptor molecule 1
Horse(100062414) toll-like receptor adaptor molecule 1
domestic cat(101082884) toll-like receptor adaptor molecule 1
dog(611852) toll-like receptor adaptor molecule 1
cow(510427) toll-like receptor adaptor molecule 1
sheep(101111016) toll-like receptor adaptor molecule 1
naked mole-rat(101721230) toll-like receptor adaptor molecule 1
domestic guinea pig(100717594) toll-like receptor adaptor molecule 1
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174989 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174989 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174989 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182919 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080021 MISSION® esiRNA esiRNA targeting mouse Ticam1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014261 Rosetta Predictions human pricing
NM_182919 Rosetta Predictions human pricing
XM_343667 Rosetta Predictions rat pricing
XR_007893 Rosetta Predictions rat pricing
NM_174989 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226929 predicted 925
2 SASI_Hs01_00226930 predicted 933
3 SASI_Hs01_00226931 predicted 936
4 SASI_Hs01_00226932 predicted 340
5 SASI_Hs01_00226933 predicted 1139
6 SASI_Hs01_00226934 predicted 928
7 SASI_Hs01_00226935 predicted 1262
8 SASI_Hs01_00226936 predicted 1133
9 SASI_Hs01_00226937 predicted 1241
10 SASI_Hs01_00226938 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371035 predicted 1754
2 SASI_Hs01_00045169 predicted 1390
3 SASI_Hs02_00371036 predicted 228
4 SASI_Hs01_00045172 predicted 808
5 SASI_Hs02_00371037 predicted 738
6 SASI_Hs01_00045173 predicted 1604
7 SASI_Hs02_00371038 predicted 1769
8 SASI_Hs01_00045177 predicted 1717
9 SASI_Hs02_00371039 predicted 216
10 SASI_Hs02_00371040 predicted 1761
11 SASI_Hs01_00045170 predicted 1405
12 SASI_Hs01_00045171 predicted 1411
13 SASI_Hs01_00045174 predicted 1398
14 SASI_Hs01_00045175 predicted 1737
15 SASI_Hs01_00045176 predicted 1599
16 SASI_Hs01_00045178 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171877 predicted 323
2 SASI_Rn01_00171878 predicted 324
3 SASI_Rn01_00171879 predicted 212
4 SASI_Rn01_00171880 predicted 399
5 SASI_Rn01_00171881 predicted 201
6 SASI_Rn01_00171882 predicted 327
7 SASI_Rn01_00171883 predicted 206
8 SASI_Rn01_00171884 predicted 378
9 SASI_Rn01_00171885 predicted 212
10 SASI_Rn01_00171886 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127200 predicted 324
2 SASI_Rn01_00127201 predicted 317
3 SASI_Rn01_00127204 predicted 321
4 SASI_Rn02_00415739 predicted 2039
5 SASI_Rn02_00415740 predicted 1973
6 SASI_Rn02_00415741 predicted 2069
7 SASI_Rn02_00415742 predicted 2079
8 SASI_Rn02_00415743 predicted 206
9 SASI_Rn02_00415744 predicted 1985
10 SASI_Rn02_00415745 predicted 2079
11 SASI_Rn01_00127199 predicted 468
12 SASI_Rn01_00127202 predicted 210
13 SASI_Rn01_00127203 predicted 403
14 SASI_Rn01_00127205 predicted 472
15 SASI_Rn01_00127206 predicted 426
16 SASI_Rn01_00127207 predicted 207
17 SASI_Rn01_00127208 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096030 predicted 1300
2 SASI_Mm01_00096031 predicted 1097
3 SASI_Mm01_00096034 predicted 1022
4 SASI_Mm01_00096035 predicted 332
5 SASI_Mm02_00345527 predicted 1295
6 SASI_Mm01_00096036 predicted 1726
7 SASI_Mm01_00096037 predicted 1040
8 SASI_Mm02_00345528 predicted 1137
9 SASI_Mm01_00096039 predicted 1662
10 SASI_Mm02_00345529 predicted 1329
11 SASI_Mm01_00096032 predicted 2366
12 SASI_Mm01_00096033 predicted 1709
13 SASI_Mm01_00096038 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014261
TICAM1 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor adaptor molecule 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000123199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-589s1c1
Sequence:CCGGTCCAACTTTCTGTAGAAGATACTCGAGTATCTTCTACAGAAAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-741s1c1
Sequence:CCGGTCCCTGGAATCATCATCGGAACTCGAGTTCCGATGATGATTCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-947s1c1
Sequence:CCGGCCTACTTCTCACCTCCAACTTCTCGAGAAGTTGGAGGTGAGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-588s1c1
Sequence:CCGGCTCCAACTTTCTGTAGAAGATCTCGAGATCTTCTACAGAAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014261
TICAM1 MISSION shRNA shRNA Plasmid DNA
toll-like receptor adaptor molecule 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000123199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-589s1c1
Sequence:CCGGTCCAACTTTCTGTAGAAGATACTCGAGTATCTTCTACAGAAAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-741s1c1
Sequence:CCGGTCCCTGGAATCATCATCGGAACTCGAGTTCCGATGATGATTCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-947s1c1
Sequence:CCGGCCTACTTCTCACCTCCAACTTCTCGAGAAGTTGGAGGTGAGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-588s1c1
Sequence:CCGGCTCCAACTTTCTGTAGAAGATCTCGAGATCTTCTACAGAAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014261
TICAM1 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor adaptor molecule 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000123199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-589s1c1
Sequence:CCGGTCCAACTTTCTGTAGAAGATACTCGAGTATCTTCTACAGAAAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-741s1c1
Sequence:CCGGTCCCTGGAATCATCATCGGAACTCGAGTTCCGATGATGATTCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-947s1c1
Sequence:CCGGCCTACTTCTCACCTCCAACTTCTCGAGAAGTTGGAGGTGAGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014261.1-588s1c1
Sequence:CCGGCTCCAACTTTCTGTAGAAGATCTCGAGATCTTCTACAGAAAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174989
TICAM1 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor adaptor molecule 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-802s1c1
Sequence:CCGGGCCAAGAACCTGAGGAGATAACTCGAGTTATCTCCTCAGGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-1007s1c1
Sequence:CCGGCACCACAGAAAGTGTTGGAAACTCGAGTTTCCAACACTTTCTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-853s1c1
Sequence:CCGGCCTTAGGGTTACCACACGAAACTCGAGTTTCGTGTGGTAACCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-2132s1c1
Sequence:CCGGGCTGGGTGTCAACAATCACATCTCGAGATGTGATTGTTGACACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-103s1c1
Sequence:CCGGGCATTCTAGGTGCCTTGGAAACTCGAGTTTCCAAGGCACCTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174989.3-1853s21c1
Sequence:CCGGAGCCTATGTCCATAGCTATAGCTCGAGCTATAGCTATGGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174989.3-925s21c1
Sequence:CCGGTAGGGTTACCACACGAAATTACTCGAGTAATTTCGTGTGGTAACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174989.3-2375s21c1
Sequence:CCGGGACTTCACCTGGGTCCTTAAACTCGAGTTTAAGGACCCAGGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174989
TICAM1 MISSION shRNA shRNA Plasmid DNA
toll-like receptor adaptor molecule 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-802s1c1
Sequence:CCGGGCCAAGAACCTGAGGAGATAACTCGAGTTATCTCCTCAGGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-1007s1c1
Sequence:CCGGCACCACAGAAAGTGTTGGAAACTCGAGTTTCCAACACTTTCTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-853s1c1
Sequence:CCGGCCTTAGGGTTACCACACGAAACTCGAGTTTCGTGTGGTAACCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-2132s1c1
Sequence:CCGGGCTGGGTGTCAACAATCACATCTCGAGATGTGATTGTTGACACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-103s1c1
Sequence:CCGGGCATTCTAGGTGCCTTGGAAACTCGAGTTTCCAAGGCACCTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174989.3-1853s21c1
Sequence:CCGGAGCCTATGTCCATAGCTATAGCTCGAGCTATAGCTATGGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174989.3-925s21c1
Sequence:CCGGTAGGGTTACCACACGAAATTACTCGAGTAATTTCGTGTGGTAACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174989.3-2375s21c1
Sequence:CCGGGACTTCACCTGGGTCCTTAAACTCGAGTTTAAGGACCCAGGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174989
TICAM1 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor adaptor molecule 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-802s1c1
Sequence:CCGGGCCAAGAACCTGAGGAGATAACTCGAGTTATCTCCTCAGGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-1007s1c1
Sequence:CCGGCACCACAGAAAGTGTTGGAAACTCGAGTTTCCAACACTTTCTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-853s1c1
Sequence:CCGGCCTTAGGGTTACCACACGAAACTCGAGTTTCGTGTGGTAACCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-2132s1c1
Sequence:CCGGGCTGGGTGTCAACAATCACATCTCGAGATGTGATTGTTGACACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174989.1-103s1c1
Sequence:CCGGGCATTCTAGGTGCCTTGGAAACTCGAGTTTCCAAGGCACCTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174989.3-1853s21c1
Sequence:CCGGAGCCTATGTCCATAGCTATAGCTCGAGCTATAGCTATGGACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174989.3-925s21c1
Sequence:CCGGTAGGGTTACCACACGAAATTACTCGAGTAATTTCGTGTGGTAACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174989.3-2375s21c1
Sequence:CCGGGACTTCACCTGGGTCCTTAAACTCGAGTTTAAGGACCCAGGTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182919
TICAM1 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor adaptor molecule 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000310294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-425s21c1
Sequence:CCGGGATCTCTCTAGAGGCATTGAACTCGAGTTCAATGCCTCTAGAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-2023s21c1
Sequence:CCGGTTGGGAGCCACATGTCATTTGCTCGAGCAAATGACATGTGGCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-1610s21c1
Sequence:CCGGCCTACTTCTCACCTCCAACTTCTCGAGAAGTTGGAGGTGAGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182919.2-2523s21c1
Sequence:CCGGTTGTCCGGGAGCCCTTCATTTCTCGAGAAATGAAGGGCTCCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182919
TICAM1 MISSION shRNA shRNA Plasmid DNA
toll-like receptor adaptor molecule 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000310294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-425s21c1
Sequence:CCGGGATCTCTCTAGAGGCATTGAACTCGAGTTCAATGCCTCTAGAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-2023s21c1
Sequence:CCGGTTGGGAGCCACATGTCATTTGCTCGAGCAAATGACATGTGGCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-1610s21c1
Sequence:CCGGCCTACTTCTCACCTCCAACTTCTCGAGAAGTTGGAGGTGAGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182919.2-2523s21c1
Sequence:CCGGTTGTCCGGGAGCCCTTCATTTCTCGAGAAATGAAGGGCTCCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182919
TICAM1 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor adaptor molecule 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000310294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-425s21c1
Sequence:CCGGGATCTCTCTAGAGGCATTGAACTCGAGTTCAATGCCTCTAGAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-2023s21c1
Sequence:CCGGTTGGGAGCCACATGTCATTTGCTCGAGCAAATGACATGTGGCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182919.2-1610s21c1
Sequence:CCGGCCTACTTCTCACCTCCAACTTCTCGAGAAGTTGGAGGTGAGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182919.2-2523s21c1
Sequence:CCGGTTGTCCGGGAGCCCTTCATTTCTCGAGAAATGAAGGGCTCCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks