EMAIL THIS PAGE TO A FRIEND

TICAM2

toll-like receptor adaptor molecule 2

Synonyms: MyD88-4 TICAM-2 TIRAP3 TIRP TRAM
UniProtKB ID: Q86XR7, B3Y698, Q6JUT2
Gene ID:
Human(353376) Summary: TIRP is a Toll/interleukin-1 receptor (IL1R; MIM 147810) (TIR) domain-containing adaptor protein involved in Toll receptor signaling (see TLR4; MIM 603030).[supplied by OMIM, Apr 2004]
Mouse(225471) toll-like receptor adaptor molecule 2
Rat(364867) toll-like receptor adaptor molecule 2
domestic guinea pig(101788890) toll-like receptor adaptor molecule 2
naked mole-rat(101727153) toll-like receptor adaptor molecule 2
Domestic Rabbit(100345225) toll-like receptor adaptor molecule 2
cow(539350) toll-like receptor adaptor molecule 2
dog(100533188) toll-like receptor adaptor molecule 2
domestic cat(101090324) toll-like receptor adaptor molecule 2
Horse(100529854) toll-like receptor adaptor molecule 2
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021649 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021649 Rosetta Predictions human pricing
NM_001108890 Rosetta Predictions rat pricing
NM_173394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020401 predicted 1615
2 SASI_Hs01_00020402 predicted 1324
3 SASI_Hs02_00355028 predicted 1525
4 SASI_Hs01_00020404 predicted 1434
5 SASI_Hs01_00020405 predicted 1293
6 SASI_Hs01_00020406 predicted 1276
7 SASI_Hs02_00355029 predicted 1057
8 SASI_Hs01_00020408 predicted 1495
9 SASI_Hs01_00020409 predicted 911
10 SASI_Hs02_00355030 predicted 1064
11 SASI_Hs01_00020403 predicted 1173
12 SASI_Hs01_00020407 predicted 1230
13 SASI_Hs01_00020410 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243095 predicted 1071
2 SASI_Rn02_00243096 predicted 1093
3 SASI_Rn02_00243097 predicted 1156
4 SASI_Rn02_00243098 predicted 943
5 SASI_Rn02_00243099 predicted 489
6 SASI_Rn02_00243100 predicted 959
7 SASI_Rn02_00243101 predicted 1097
8 SASI_Rn02_00243102 predicted 876
9 SASI_Rn02_00243103 predicted 831
10 SASI_Rn02_00243104 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050689 predicted 887
2 SASI_Mm01_00050690 predicted 1047
3 SASI_Mm01_00050691 predicted 1031
4 SASI_Mm01_00050692 predicted 903
5 SASI_Mm01_00050694 predicted 1102
6 SASI_Mm01_00050695 predicted 1273
7 SASI_Mm02_00345228 predicted 1211
8 SASI_Mm02_00345229 predicted 868
9 SASI_Mm01_00050696 predicted 1108
10 SASI_Mm01_00050697 predicted 693
11 SASI_Mm01_00050693 predicted 1077
12 SASI_Mm01_00050698 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173394
TICAM2 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor adaptor molecule 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173394.2-1140s21c1
Sequence:CCGGCACGAAGTGTGTCGCAGAAACCTCGAGGTTTCTGCGACACACTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173394.2-1415s21c1
Sequence:CCGGTTCTTGTGTTGAGCCATAAACCTCGAGGTTTATGGCTCAACACAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173394.2-1226s21c1
Sequence:CCGGTTCACTTGAGAGAGTAGTTTCCTCGAGGAAACTACTCTCTCAAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-1148s1c1
Sequence:CCGGGTGTCGCAGAAACAGTTCATTCTCGAGAATGAACTGTTTCTGCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-553s1c1
Sequence:CCGGCGGCCATGAGTCAGACTCCAACTCGAGTTGGAGTCTGACTCATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-958s1c1
Sequence:CCGGGCACAAGTACAACTCCGTCATCTCGAGATGACGGAGTTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-1030s1c1
Sequence:CCGGGCTGCAAACCATCAATGCCTTCTCGAGAAGGCATTGATGGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173394.2-2814s1c1
Sequence:CCGGGCCACTGTTTACTTCTTTATACTCGAGTATAAAGAAGTAAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173394
TICAM2 MISSION shRNA shRNA Plasmid DNA
toll-like receptor adaptor molecule 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173394.2-1140s21c1
Sequence:CCGGCACGAAGTGTGTCGCAGAAACCTCGAGGTTTCTGCGACACACTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173394.2-1415s21c1
Sequence:CCGGTTCTTGTGTTGAGCCATAAACCTCGAGGTTTATGGCTCAACACAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173394.2-1226s21c1
Sequence:CCGGTTCACTTGAGAGAGTAGTTTCCTCGAGGAAACTACTCTCTCAAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-1148s1c1
Sequence:CCGGGTGTCGCAGAAACAGTTCATTCTCGAGAATGAACTGTTTCTGCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-553s1c1
Sequence:CCGGCGGCCATGAGTCAGACTCCAACTCGAGTTGGAGTCTGACTCATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-958s1c1
Sequence:CCGGGCACAAGTACAACTCCGTCATCTCGAGATGACGGAGTTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-1030s1c1
Sequence:CCGGGCTGCAAACCATCAATGCCTTCTCGAGAAGGCATTGATGGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173394.2-2814s1c1
Sequence:CCGGGCCACTGTTTACTTCTTTATACTCGAGTATAAAGAAGTAAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173394
TICAM2 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor adaptor molecule 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173394.2-1140s21c1
Sequence:CCGGCACGAAGTGTGTCGCAGAAACCTCGAGGTTTCTGCGACACACTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173394.2-1415s21c1
Sequence:CCGGTTCTTGTGTTGAGCCATAAACCTCGAGGTTTATGGCTCAACACAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173394.2-1226s21c1
Sequence:CCGGTTCACTTGAGAGAGTAGTTTCCTCGAGGAAACTACTCTCTCAAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-1148s1c1
Sequence:CCGGGTGTCGCAGAAACAGTTCATTCTCGAGAATGAACTGTTTCTGCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-553s1c1
Sequence:CCGGCGGCCATGAGTCAGACTCCAACTCGAGTTGGAGTCTGACTCATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-958s1c1
Sequence:CCGGGCACAAGTACAACTCCGTCATCTCGAGATGACGGAGTTGTACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173394.2-1030s1c1
Sequence:CCGGGCTGCAAACCATCAATGCCTTCTCGAGAAGGCATTGATGGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173394.2-2814s1c1
Sequence:CCGGGCCACTGTTTACTTCTTTATACTCGAGTATAAAGAAGTAAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021649
TICAM2 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor adaptor molecule 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021649.5-1578s21c1
Sequence:CCGGTGTTAAGCGTTGATGCATATACTCGAGTATATGCATCAACGCTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021649.5-687s21c1
Sequence:CCGGTGGTATCAAACCCGGAATAATCTCGAGATTATTCCGGGTTTGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021649.5-854s21c1
Sequence:CCGGCCGTTAACAGGCAGCATAAATCTCGAGATTTATGCTGCCTGTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021649.3-2735s1c1
Sequence:CCGGGCAAACTATTTACCCTCCTTTCTCGAGAAAGGAGGGTAAATAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1171s1c1
Sequence:CCGGCGGAATAATCTTTGCTGAGATCTCGAGATCTCAGCAAAGATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1454s1c1
Sequence:CCGGCCTACACAAGTAGAAAGAATTCTCGAGAATTCTTTCTACTTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1200s1c1
Sequence:CCGGGCAGACAGCATTTACAGAATTCTCGAGAATTCTGTAAATGCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1300s1c1
Sequence:CCGGCCAGTTCTATACGTCCCTAATCTCGAGATTAGGGACGTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021649
TICAM2 MISSION shRNA shRNA Plasmid DNA
toll-like receptor adaptor molecule 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021649.5-1578s21c1
Sequence:CCGGTGTTAAGCGTTGATGCATATACTCGAGTATATGCATCAACGCTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021649.5-687s21c1
Sequence:CCGGTGGTATCAAACCCGGAATAATCTCGAGATTATTCCGGGTTTGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021649.5-854s21c1
Sequence:CCGGCCGTTAACAGGCAGCATAAATCTCGAGATTTATGCTGCCTGTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021649.3-2735s1c1
Sequence:CCGGGCAAACTATTTACCCTCCTTTCTCGAGAAAGGAGGGTAAATAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1171s1c1
Sequence:CCGGCGGAATAATCTTTGCTGAGATCTCGAGATCTCAGCAAAGATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1454s1c1
Sequence:CCGGCCTACACAAGTAGAAAGAATTCTCGAGAATTCTTTCTACTTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1200s1c1
Sequence:CCGGGCAGACAGCATTTACAGAATTCTCGAGAATTCTGTAAATGCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1300s1c1
Sequence:CCGGCCAGTTCTATACGTCCCTAATCTCGAGATTAGGGACGTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021649
TICAM2 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor adaptor molecule 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021649.5-1578s21c1
Sequence:CCGGTGTTAAGCGTTGATGCATATACTCGAGTATATGCATCAACGCTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021649.5-687s21c1
Sequence:CCGGTGGTATCAAACCCGGAATAATCTCGAGATTATTCCGGGTTTGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021649.5-854s21c1
Sequence:CCGGCCGTTAACAGGCAGCATAAATCTCGAGATTTATGCTGCCTGTTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021649.3-2735s1c1
Sequence:CCGGGCAAACTATTTACCCTCCTTTCTCGAGAAAGGAGGGTAAATAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1171s1c1
Sequence:CCGGCGGAATAATCTTTGCTGAGATCTCGAGATCTCAGCAAAGATTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1454s1c1
Sequence:CCGGCCTACACAAGTAGAAAGAATTCTCGAGAATTCTTTCTACTTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1200s1c1
Sequence:CCGGGCAGACAGCATTTACAGAATTCTCGAGAATTCTGTAAATGCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021649.3-1300s1c1
Sequence:CCGGCCAGTTCTATACGTCCCTAATCTCGAGATTAGGGACGTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks