EMAIL THIS PAGE TO A FRIEND

TICRR

TOPBP1-interacting checkpoint and replication regulator

Synonyms: C15orf42 SLD3 Treslin
Gene ID:
Human(90381) Summary: Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]
Mouse(77011) TOPBP1-interacting checkpoint and replication regulator
Rat(308768) TOPBP1-interacting checkpoint and replication regulator
cow(529868) TOPBP1-interacting checkpoint and replication regulator
sheep(101123667) TOPBP1-interacting checkpoint and replication regulator
naked mole-rat(101703037) TOPBP1-interacting checkpoint and replication regulator
domestic guinea pig(100728636) TOPBP1-interacting checkpoint and replication regulator
Zebrafish(445411) TopBP1-interacting, checkpoint, and replication regulator
domestic cat(101090870) TOPBP1-interacting checkpoint and replication regulator
dog(609269) TOPBP1-interacting checkpoint and replication regulator
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080401 MISSION® esiRNA esiRNA human C15orf42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152259 Rosetta Predictions human pricing
XM_001065296 Rosetta Predictions rat pricing
XM_218829 Rosetta Predictions rat pricing
NM_029835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365753 predicted 2903
2 SASI_Hs02_00365754 predicted 681
3 SASI_Hs02_00365755 predicted 589
4 SASI_Hs02_00365756 predicted 3634
5 SASI_Hs02_00365757 predicted 1341
6 SASI_Hs02_00365758 predicted 3018
7 SASI_Hs02_00365759 predicted 1920
8 SASI_Hs02_00365760 predicted 3438
9 SASI_Hs02_00365761 predicted 569
10 SASI_Hs02_00365762 predicted 2421
11 SASI_Hs01_00207803 predicted 335
12 SASI_Hs01_00207804 predicted 2131
13 SASI_Hs01_00207805 predicted 2225
14 SASI_Hs01_00207806 predicted 1789
15 SASI_Hs01_00207807 predicted 1879
16 SASI_Hs01_00207808 predicted 382
17 SASI_Hs01_00207809 predicted 379
18 SASI_Hs01_00207810 predicted 2216
19 SASI_Hs01_00207811 predicted 418
20 SASI_Hs01_00207812 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313615 predicted 1048
2 SASI_Rn02_00313616 predicted 980
3 SASI_Rn02_00313617 predicted 1512
4 SASI_Rn02_00313618 predicted 999
5 SASI_Rn02_00313619 predicted 744
6 SASI_Rn02_00313620 predicted 1121
7 SASI_Rn02_00313621 predicted 3381
8 SASI_Rn02_00313622 predicted 1782
9 SASI_Rn02_00313623 predicted 4013
10 SASI_Rn02_00313624 predicted 4905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378112 predicted 5411
2 SASI_Rn02_00378113 predicted 5494
3 SASI_Rn02_00378114 predicted 5363
4 SASI_Rn02_00378115 predicted 5374
5 SASI_Rn02_00378116 predicted 4917
6 SASI_Rn02_00378117 predicted 5482
7 SASI_Rn02_00378118 predicted 4986
8 SASI_Rn02_00378119 predicted 4902
9 SASI_Rn02_00378120 predicted 5422
10 SASI_Rn02_00378121 predicted 5271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189742 predicted 1513
2 SASI_Mm01_00189743 predicted 2355
3 SASI_Mm01_00189744 predicted 2390
4 SASI_Mm01_00189745 predicted 1497
5 SASI_Mm01_00189746 predicted 4410
6 SASI_Mm01_00189747 predicted 1043
7 SASI_Mm01_00189748 predicted 747
8 SASI_Mm01_00189749 predicted 5791
9 SASI_Mm01_00189750 predicted 2625
10 SASI_Mm01_00189751 predicted 3523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152259
VALIDATED
TICRR MISSION shRNA Bacterial Glycerol Stock
TOPBP1-interacting checkpoint and replication regulator
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152259.2-2437s1c1
Sequence:CCGGGCAATGTGATTGGTGCTATAACTCGAGTTATAGCACCAATCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152259.2-642s1c1
Sequence:CCGGCGGTGTAGAAAGACCTCTGATCTCGAGATCAGAGGTCTTTCTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-402s1c1
Sequence:CCGGCCACCTGTTACGCCAAAGAAACTCGAGTTTCTTTGGCGTAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-401s1c1
Sequence:CCGGCCCACCTGTTACGCCAAAGAACTCGAGTTCTTTGGCGTAACAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-1461s1c1
Sequence:CCGGCCCTCTCCATTTCAAACAGATCTCGAGATCTGTTTGAAATGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-931s1c1
Sequence:CCGGGTAACGTCTTATCAGTGGAAGCTCGAGCTTCCACTGATAAGACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-582s1c1
Sequence:CCGGCTCTCACAGAGAGCTACATTGCTCGAGCAATGTAGCTCTCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-1882s1c1
Sequence:CCGGCAGAAGTTAGTAAGAGTAAAGCTCGAGCTTTACTCTTACTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-2700s1c1
Sequence:CCGGCCTTCCCTGTGTAACAGTAAACTCGAGTTTACTGTTACACAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152259.3-2725s21c1
Sequence:GTACCGGGTGACCAAAGTTCGAAGAAATCTCGAGATTTCTTCGAACTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152259.3-2152s21c1
Sequence:GTACCGGGAGTGCCAGCTTCAGGTATTTCTCGAGAAATACCTGAAGCTGGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152259
VALIDATED
TICRR MISSION shRNA shRNA Plasmid DNA
TOPBP1-interacting checkpoint and replication regulator
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152259.2-2437s1c1
Sequence:CCGGGCAATGTGATTGGTGCTATAACTCGAGTTATAGCACCAATCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152259.2-642s1c1
Sequence:CCGGCGGTGTAGAAAGACCTCTGATCTCGAGATCAGAGGTCTTTCTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-402s1c1
Sequence:CCGGCCACCTGTTACGCCAAAGAAACTCGAGTTTCTTTGGCGTAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-401s1c1
Sequence:CCGGCCCACCTGTTACGCCAAAGAACTCGAGTTCTTTGGCGTAACAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-1461s1c1
Sequence:CCGGCCCTCTCCATTTCAAACAGATCTCGAGATCTGTTTGAAATGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-931s1c1
Sequence:CCGGGTAACGTCTTATCAGTGGAAGCTCGAGCTTCCACTGATAAGACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-582s1c1
Sequence:CCGGCTCTCACAGAGAGCTACATTGCTCGAGCAATGTAGCTCTCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-1882s1c1
Sequence:CCGGCAGAAGTTAGTAAGAGTAAAGCTCGAGCTTTACTCTTACTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-2700s1c1
Sequence:CCGGCCTTCCCTGTGTAACAGTAAACTCGAGTTTACTGTTACACAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152259.3-2725s21c1
Sequence:GTACCGGGTGACCAAAGTTCGAAGAAATCTCGAGATTTCTTCGAACTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152259.3-2152s21c1
Sequence:GTACCGGGAGTGCCAGCTTCAGGTATTTCTCGAGAAATACCTGAAGCTGGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152259
VALIDATED
TICRR MISSION shRNA Lentiviral Transduction Particles
TOPBP1-interacting checkpoint and replication regulator
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152259.2-2437s1c1
Sequence:CCGGGCAATGTGATTGGTGCTATAACTCGAGTTATAGCACCAATCACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152259.2-642s1c1
Sequence:CCGGCGGTGTAGAAAGACCTCTGATCTCGAGATCAGAGGTCTTTCTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-402s1c1
Sequence:CCGGCCACCTGTTACGCCAAAGAAACTCGAGTTTCTTTGGCGTAACAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-401s1c1
Sequence:CCGGCCCACCTGTTACGCCAAAGAACTCGAGTTCTTTGGCGTAACAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152259.2-1461s1c1
Sequence:CCGGCCCTCTCCATTTCAAACAGATCTCGAGATCTGTTTGAAATGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-931s1c1
Sequence:CCGGGTAACGTCTTATCAGTGGAAGCTCGAGCTTCCACTGATAAGACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-582s1c1
Sequence:CCGGCTCTCACAGAGAGCTACATTGCTCGAGCAATGTAGCTCTCTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-1882s1c1
Sequence:CCGGCAGAAGTTAGTAAGAGTAAAGCTCGAGCTTTACTCTTACTAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152259.2-2700s1c1
Sequence:CCGGCCTTCCCTGTGTAACAGTAAACTCGAGTTTACTGTTACACAGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152259.3-2725s21c1
Sequence:GTACCGGGTGACCAAAGTTCGAAGAAATCTCGAGATTTCTTCGAACTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152259.3-2152s21c1
Sequence:GTACCGGGAGTGCCAGCTTCAGGTATTTCTCGAGAAATACCTGAAGCTGGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029835
TICRR MISSION shRNA Bacterial Glycerol Stock
TOPBP1-interacting checkpoint and replication regulator
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000183420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029835.1-1418s1c1
Sequence:CCGGCCAAAGAAGCTGAATTTCAAACTCGAGTTTGAAATTCAGCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029835
TICRR MISSION shRNA shRNA Plasmid DNA
TOPBP1-interacting checkpoint and replication regulator
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000183420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029835.1-1418s1c1
Sequence:CCGGCCAAAGAAGCTGAATTTCAAACTCGAGTTTGAAATTCAGCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029835
TICRR MISSION shRNA Lentiviral Transduction Particles
TOPBP1-interacting checkpoint and replication regulator
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000183420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029835.1-1418s1c1
Sequence:CCGGCCAAAGAAGCTGAATTTCAAACTCGAGTTTGAAATTCAGCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks