EMAIL THIS PAGE TO A FRIEND

TIE1

tyrosine kinase with immunoglobulin-like and EGF-like domains 1

Synonyms: JTK14 TIE
UniProtKB ID: P35590, B5A949, B5A950
Gene ID:
Human(7075) Summary: This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(21846) tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Rat(89806) tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Zebrafish(30746) endothelium-specific receptor tyrosine kinase 1
domestic cat(101080986) tyrosine kinase with immunoglobulin-like and EGF-like domains 1
dog(482535) tyrosine kinase with immunoglobulin-like and EGF-like domains 1
chicken(424562) tyrosine kinase with immunoglobulin-like and EGF-like domains 1
domestic guinea pig(100717986) tyrosine kinase with immunoglobulin-like and EGF-like domains 1
naked mole-rat(101704223) tyrosine kinase with immunoglobulin-like and EGF-like domains 1
cow(280941) tyrosine kinase with immunoglobulin-like and EGF-like domains 1
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T2817 Anti-Tie 1 antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, western blot pricing
SAB1306381 ANTI-TIE(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1411975 ANTI-TIE1 antibody produced in mouse clone 2G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411976 ANTI-TIE1 antibody produced in mouse clone 1G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412573 ANTI-TIE1 antibody produced in mouse clone 3E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412574 ANTI-TIE1 antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412575 ANTI-TIE1 antibody produced in mouse clone 1G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0007075M16 Monoclonal Anti-TIE1 antibody produced in mouse clone 3E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404469 Monoclonal Anti-TIE1 antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145061 MISSION® esiRNA esiRNA human TIE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005424 Rosetta Predictions human pricing
NM_053545 Rosetta Predictions rat pricing
NM_011587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243662 predicted 643
2 SASI_Hs01_00243663 predicted 3038
3 SASI_Hs01_00243664 predicted 3135
4 SASI_Hs01_00243665 predicted 835
5 SASI_Hs01_00243666 predicted 3436
6 SASI_Hs01_00243667 predicted 2663
7 SASI_Hs01_00243668 predicted 1613
8 SASI_Hs01_00243669 predicted 3562
9 SASI_Hs01_00243670 predicted 2094
10 SASI_Hs01_00243671 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266167 predicted 2773
2 SASI_Rn02_00266168 predicted 759
3 SASI_Rn02_00266169 predicted 3410
4 SASI_Rn02_00266170 predicted 3230
5 SASI_Rn02_00266171 predicted 2424
6 SASI_Rn02_00266172 predicted 3406
7 SASI_Rn02_00266173 predicted 3103
8 SASI_Rn02_00266174 predicted 2599
9 SASI_Rn02_00266175 predicted 338
10 SASI_Rn02_00266176 predicted 2493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167138 predicted 2665
2 SASI_Mm01_00167141 predicted 839
3 SASI_Mm01_00167142 predicted 2539
4 SASI_Mm01_00167140 predicted 3192
5 SASI_Mm02_00320982 predicted 3215
6 SASI_Mm01_00167143 predicted 2231
7 SASI_Mm02_00320983 predicted 1443
8 SASI_Mm01_00167144 predicted 2681
9 SASI_Mm01_00167145 predicted 610
10 SASI_Mm01_00167146 predicted 2233
11 SASI_Mm01_00167139 predicted 3429
12 SASI_Mm01_00167147 predicted 3075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005424
VALIDATED
TIE1 MISSION shRNA Bacterial Glycerol Stock
tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Human
32 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2841s21c1
Sequence:GTACCGGCCTACGGGAACCTGCTAGATTCTCGAGAATCTAGCAGGTTCCCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005424.2-3578s21c1
Sequence:CCGGCTCTGACTTAAGCTGCCTCAACTCGAGTTGAGGCAGCTTAAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2515s21c1
Sequence:CCGGCTCAGGGACCTTGACACTTACCTCGAGGTAAGTGTCAAGGTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-493s21c1
Sequence:CCGGAGGTGACACCGCTGTACTTTCCTCGAGGAAAGTACAGCGGTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-1152s21c1
Sequence:CCGGCAGAACTGGAGTTCAACTTAGCTCGAGCTAAGTTGAACTCCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2740s21c1
Sequence:CCGGACTGGAAGTTCTGTGCAAATTCTCGAGAATTTGCACAGAACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-796s21c1
Sequence:GTACCGGCCATGACGGCGAATGTGTATGCTCGAGCATACACATTCGCCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-1580s21c1
Sequence:GTACCGGAGTGAGAACGTGACGTTAATGCTCGAGCATTAACGTCACGTTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-3429s21c1
Sequence:GTACCGGATGTGAACATGTCGCTGTTTGCTCGAGCAAACAGCGACATGTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-2692s1c1
Sequence:CCGGGCTGAAAGAGTATGCCTCTGACTCGAGTCAGAGGCATACTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-2811s1c1
Sequence:CCGGGTTACTTGTATATCGCTATTGCTCGAGCAATAGCGATATACAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-693s1c1
Sequence:CCGGGCGCCTTCTTTCGGCTCATCGCTCGAGCGATGAGCCGAAAGAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-1050s1c1
Sequence:CCGGGTGGCACTTGTGACCGGTTCACTCGAGTGAACCGGTCACAAGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.2-3578s1c1
Sequence:CCGGCTCTGACTTAAGCTGCCTCAACTCGAGTTGAGGCAGCTTAAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.2-789s1c1
Sequence:CCGGGCCACGACCATGACGGCGAATCTCGAGATTCGCCGTCATGGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2170s1c1
Sequence:CCGGGCCTGAGGAGACAAGCACCATCTCGAGATGGTGCTTGTCTCCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2258s1c1
Sequence:CCGGGACTGGAGCAACACAGTAGAACTCGAGTTCTACTGTGTTGCTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.2-3530s1c1
Sequence:CCGGCGGAGCAAACTCTGCTGTCTACTCGAGTAGACAGCAGAGTTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3427s1c1
Sequence:CCGGCTATGTGAACATGTCGCTGTTCTCGAGAACAGCGACATGTTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2095s1c1
Sequence:CCGGGCCAATATCCAAGTACGTTGTCTCGAGACAACGTACTTGGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2842s1c1
Sequence:CCGGCTACGGGAACCTGCTAGATTTCTCGAGAAATCTAGCAGGTTCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2803s1c1
Sequence:CCGGGAACCGAGGTTACTTGTATATCTCGAGATATACAAGTAACCTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3302s1c1
Sequence:CCGGCCTCGAAACTGTGACGATGAACTCGAGTTCATCGTCACAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-1578s1c1
Sequence:CCGGCCAGTGAGAACGTGACGTTAACTCGAGTTAACGTCACGTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3150s1c1
Sequence:CCGGCCCTGAACTACAGTGTCTATACTCGAGTATAGACACTGTAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.2-3669s1c1
Sequence:CCGGCATGCTTTGTAGGTGTCTCATCTCGAGATGAGACACCTACAAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2986s1c1
Sequence:CCGGCCTGAGTGAGAAGCAGTTCATCTCGAGATGAACTGCTTCTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-1605s1c1
Sequence:CCGGTGAGGCCAAAGACAGGATACACTCGAGTGTATCCTGTCTTTGGCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.x-3316s1c1
Sequence:CCGGCGATGAAGTGTACGAGCTGATCTCGAGATCAGCTCGTACACTTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.x-3795s1c1
Sequence:CCGGCAGCACTCACACCACTAACATCTCGAGATGTTAGTGGTGTGAGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-3206s1c1
Sequence:CCGGCTTTGGGAGATAGTGAGCCTTCTCGAGAAGGCTCACTATCTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-3088s1c1
Sequence:CCGGAGAGGAGGTTTATGTGAAGAACTCGAGTTCTTCACATAAACCTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005424
VALIDATED
TIE1 MISSION shRNA shRNA Plasmid DNA
tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Human
32 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2841s21c1
Sequence:GTACCGGCCTACGGGAACCTGCTAGATTCTCGAGAATCTAGCAGGTTCCCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005424.2-3578s21c1
Sequence:CCGGCTCTGACTTAAGCTGCCTCAACTCGAGTTGAGGCAGCTTAAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2515s21c1
Sequence:CCGGCTCAGGGACCTTGACACTTACCTCGAGGTAAGTGTCAAGGTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-493s21c1
Sequence:CCGGAGGTGACACCGCTGTACTTTCCTCGAGGAAAGTACAGCGGTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-1152s21c1
Sequence:CCGGCAGAACTGGAGTTCAACTTAGCTCGAGCTAAGTTGAACTCCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2740s21c1
Sequence:CCGGACTGGAAGTTCTGTGCAAATTCTCGAGAATTTGCACAGAACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-796s21c1
Sequence:GTACCGGCCATGACGGCGAATGTGTATGCTCGAGCATACACATTCGCCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-1580s21c1
Sequence:GTACCGGAGTGAGAACGTGACGTTAATGCTCGAGCATTAACGTCACGTTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-3429s21c1
Sequence:GTACCGGATGTGAACATGTCGCTGTTTGCTCGAGCAAACAGCGACATGTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-2692s1c1
Sequence:CCGGGCTGAAAGAGTATGCCTCTGACTCGAGTCAGAGGCATACTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-2811s1c1
Sequence:CCGGGTTACTTGTATATCGCTATTGCTCGAGCAATAGCGATATACAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-693s1c1
Sequence:CCGGGCGCCTTCTTTCGGCTCATCGCTCGAGCGATGAGCCGAAAGAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-1050s1c1
Sequence:CCGGGTGGCACTTGTGACCGGTTCACTCGAGTGAACCGGTCACAAGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.2-3578s1c1
Sequence:CCGGCTCTGACTTAAGCTGCCTCAACTCGAGTTGAGGCAGCTTAAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.2-789s1c1
Sequence:CCGGGCCACGACCATGACGGCGAATCTCGAGATTCGCCGTCATGGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2170s1c1
Sequence:CCGGGCCTGAGGAGACAAGCACCATCTCGAGATGGTGCTTGTCTCCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2258s1c1
Sequence:CCGGGACTGGAGCAACACAGTAGAACTCGAGTTCTACTGTGTTGCTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.2-3530s1c1
Sequence:CCGGCGGAGCAAACTCTGCTGTCTACTCGAGTAGACAGCAGAGTTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3427s1c1
Sequence:CCGGCTATGTGAACATGTCGCTGTTCTCGAGAACAGCGACATGTTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2095s1c1
Sequence:CCGGGCCAATATCCAAGTACGTTGTCTCGAGACAACGTACTTGGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2842s1c1
Sequence:CCGGCTACGGGAACCTGCTAGATTTCTCGAGAAATCTAGCAGGTTCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2803s1c1
Sequence:CCGGGAACCGAGGTTACTTGTATATCTCGAGATATACAAGTAACCTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3302s1c1
Sequence:CCGGCCTCGAAACTGTGACGATGAACTCGAGTTCATCGTCACAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-1578s1c1
Sequence:CCGGCCAGTGAGAACGTGACGTTAACTCGAGTTAACGTCACGTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3150s1c1
Sequence:CCGGCCCTGAACTACAGTGTCTATACTCGAGTATAGACACTGTAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.2-3669s1c1
Sequence:CCGGCATGCTTTGTAGGTGTCTCATCTCGAGATGAGACACCTACAAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2986s1c1
Sequence:CCGGCCTGAGTGAGAAGCAGTTCATCTCGAGATGAACTGCTTCTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-1605s1c1
Sequence:CCGGTGAGGCCAAAGACAGGATACACTCGAGTGTATCCTGTCTTTGGCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.x-3316s1c1
Sequence:CCGGCGATGAAGTGTACGAGCTGATCTCGAGATCAGCTCGTACACTTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.x-3795s1c1
Sequence:CCGGCAGCACTCACACCACTAACATCTCGAGATGTTAGTGGTGTGAGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-3206s1c1
Sequence:CCGGCTTTGGGAGATAGTGAGCCTTCTCGAGAAGGCTCACTATCTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-3088s1c1
Sequence:CCGGAGAGGAGGTTTATGTGAAGAACTCGAGTTCTTCACATAAACCTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005424
VALIDATED
TIE1 MISSION shRNA Lentiviral Transduction Particles
tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Human
32 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2841s21c1
Sequence:GTACCGGCCTACGGGAACCTGCTAGATTCTCGAGAATCTAGCAGGTTCCCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005424.2-3578s21c1
Sequence:CCGGCTCTGACTTAAGCTGCCTCAACTCGAGTTGAGGCAGCTTAAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2515s21c1
Sequence:CCGGCTCAGGGACCTTGACACTTACCTCGAGGTAAGTGTCAAGGTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-493s21c1
Sequence:CCGGAGGTGACACCGCTGTACTTTCCTCGAGGAAAGTACAGCGGTGTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-1152s21c1
Sequence:CCGGCAGAACTGGAGTTCAACTTAGCTCGAGCTAAGTTGAACTCCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-2740s21c1
Sequence:CCGGACTGGAAGTTCTGTGCAAATTCTCGAGAATTTGCACAGAACTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-796s21c1
Sequence:GTACCGGCCATGACGGCGAATGTGTATGCTCGAGCATACACATTCGCCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-1580s21c1
Sequence:GTACCGGAGTGAGAACGTGACGTTAATGCTCGAGCATTAACGTCACGTTCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005424.2-3429s21c1
Sequence:GTACCGGATGTGAACATGTCGCTGTTTGCTCGAGCAAACAGCGACATGTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-2692s1c1
Sequence:CCGGGCTGAAAGAGTATGCCTCTGACTCGAGTCAGAGGCATACTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-2811s1c1
Sequence:CCGGGTTACTTGTATATCGCTATTGCTCGAGCAATAGCGATATACAAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-693s1c1
Sequence:CCGGGCGCCTTCTTTCGGCTCATCGCTCGAGCGATGAGCCGAAAGAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005424.2-1050s1c1
Sequence:CCGGGTGGCACTTGTGACCGGTTCACTCGAGTGAACCGGTCACAAGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.2-3578s1c1
Sequence:CCGGCTCTGACTTAAGCTGCCTCAACTCGAGTTGAGGCAGCTTAAGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.2-789s1c1
Sequence:CCGGGCCACGACCATGACGGCGAATCTCGAGATTCGCCGTCATGGTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2170s1c1
Sequence:CCGGGCCTGAGGAGACAAGCACCATCTCGAGATGGTGCTTGTCTCCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2258s1c1
Sequence:CCGGGACTGGAGCAACACAGTAGAACTCGAGTTCTACTGTGTTGCTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.2-3530s1c1
Sequence:CCGGCGGAGCAAACTCTGCTGTCTACTCGAGTAGACAGCAGAGTTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3427s1c1
Sequence:CCGGCTATGTGAACATGTCGCTGTTCTCGAGAACAGCGACATGTTCACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2095s1c1
Sequence:CCGGGCCAATATCCAAGTACGTTGTCTCGAGACAACGTACTTGGATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2842s1c1
Sequence:CCGGCTACGGGAACCTGCTAGATTTCTCGAGAAATCTAGCAGGTTCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2803s1c1
Sequence:CCGGGAACCGAGGTTACTTGTATATCTCGAGATATACAAGTAACCTCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3302s1c1
Sequence:CCGGCCTCGAAACTGTGACGATGAACTCGAGTTCATCGTCACAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-1578s1c1
Sequence:CCGGCCAGTGAGAACGTGACGTTAACTCGAGTTAACGTCACGTTCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-3150s1c1
Sequence:CCGGCCCTGAACTACAGTGTCTATACTCGAGTATAGACACTGTAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.2-3669s1c1
Sequence:CCGGCATGCTTTGTAGGTGTCTCATCTCGAGATGAGACACCTACAAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.2-2986s1c1
Sequence:CCGGCCTGAGTGAGAAGCAGTTCATCTCGAGATGAACTGCTTCTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-1605s1c1
Sequence:CCGGTGAGGCCAAAGACAGGATACACTCGAGTGTATCCTGTCTTTGGCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005424.x-3316s1c1
Sequence:CCGGCGATGAAGTGTACGAGCTGATCTCGAGATCAGCTCGTACACTTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005424.x-3795s1c1
Sequence:CCGGCAGCACTCACACCACTAACATCTCGAGATGTTAGTGGTGTGAGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-3206s1c1
Sequence:CCGGCTTTGGGAGATAGTGAGCCTTCTCGAGAAGGCTCACTATCTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005424.x-3088s1c1
Sequence:CCGGAGAGGAGGTTTATGTGAAGAACTCGAGTTCTTCACATAAACCTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011587
TIE1 MISSION shRNA Bacterial Glycerol Stock
tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-2255s21c1
Sequence:CCGGTCAATGCTAGCACACGATATCCTCGAGGATATCGTGTGCTAGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-3482s21c1
Sequence:CCGGACGTGAACATGTCGCTGTTTGCTCGAGCAAACAGCGACATGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-3203s21c1
Sequence:CCGGCCCTCAACTACAGCGTCTATACTCGAGTATAGACGCTGTAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-1664s1c1
Sequence:CCGGCGCTTCAAGGTCAATGTCAAACTCGAGTTTGACATTGACCTTGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-2990s1c1
Sequence:CCGGCGAGACTTTGCAGGTGAACTACTCGAGTAGTTCACCTGCAAAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-2691s1c1
Sequence:CCGGCCTTGGTGTGTATCCGAAGAACTCGAGTTCTTCGGATACACACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-3417s1c1
Sequence:CCGGCCCTCAACTACAGCGTTTATACTCGAGTATAAACGCTGTAGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-1851s1c1
Sequence:CCGGCCAGTGAGAATGTGACATTAACTCGAGTTAATGTCACATTCTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011587
TIE1 MISSION shRNA shRNA Plasmid DNA
tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-2255s21c1
Sequence:CCGGTCAATGCTAGCACACGATATCCTCGAGGATATCGTGTGCTAGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-3482s21c1
Sequence:CCGGACGTGAACATGTCGCTGTTTGCTCGAGCAAACAGCGACATGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-3203s21c1
Sequence:CCGGCCCTCAACTACAGCGTCTATACTCGAGTATAGACGCTGTAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-1664s1c1
Sequence:CCGGCGCTTCAAGGTCAATGTCAAACTCGAGTTTGACATTGACCTTGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-2990s1c1
Sequence:CCGGCGAGACTTTGCAGGTGAACTACTCGAGTAGTTCACCTGCAAAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-2691s1c1
Sequence:CCGGCCTTGGTGTGTATCCGAAGAACTCGAGTTCTTCGGATACACACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-3417s1c1
Sequence:CCGGCCCTCAACTACAGCGTTTATACTCGAGTATAAACGCTGTAGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-1851s1c1
Sequence:CCGGCCAGTGAGAATGTGACATTAACTCGAGTTAATGTCACATTCTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011587
TIE1 MISSION shRNA Lentiviral Transduction Particles
tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-2255s21c1
Sequence:CCGGTCAATGCTAGCACACGATATCCTCGAGGATATCGTGTGCTAGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-3482s21c1
Sequence:CCGGACGTGAACATGTCGCTGTTTGCTCGAGCAAACAGCGACATGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011587.2-3203s21c1
Sequence:CCGGCCCTCAACTACAGCGTCTATACTCGAGTATAGACGCTGTAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-1664s1c1
Sequence:CCGGCGCTTCAAGGTCAATGTCAAACTCGAGTTTGACATTGACCTTGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-2990s1c1
Sequence:CCGGCGAGACTTTGCAGGTGAACTACTCGAGTAGTTCACCTGCAAAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-2691s1c1
Sequence:CCGGCCTTGGTGTGTATCCGAAGAACTCGAGTTCTTCGGATACACACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-3417s1c1
Sequence:CCGGCCCTCAACTACAGCGTTTATACTCGAGTATAAACGCTGTAGTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011587.1-1851s1c1
Sequence:CCGGCCAGTGAGAATGTGACATTAACTCGAGTTAATGTCACATTCTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks