EMAIL THIS PAGE TO A FRIEND

TIFA

TRAF-interacting protein with forkhead-associated domain

Synonyms: T2BP T6BP TIFAA
UniProtKB ID: Q96CG3
Gene ID:
Mouse(211550) TRAF-interacting protein with forkhead-associated domain
Rat(310877) TRAF-interacting protein with forkhead-associated domain
chicken(422692) TRAF-interacting protein with forkhead-associated domain
dog(487905) TRAF-interacting protein with forkhead-associated domain
domestic cat(101080453) TRAF-interacting protein with forkhead-associated domain
cow(783855) TRAF-interacting protein with forkhead-associated domain
sheep(101116728) TRAF-interacting protein with forkhead-associated domain
naked mole-rat(101724770) TRAF-interacting protein with forkhead-associated domain
domestic guinea pig(100716158) TRAF-interacting protein with forkhead-associated domain
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052864 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065061 MISSION® esiRNA esiRNA targeting mouse Tifa (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052864 Rosetta Predictions human pricing
NM_001014044 Rosetta Predictions rat pricing
NM_145133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361560 predicted 576
2 SASI_Hs01_00053068 predicted 323
3 SASI_Hs02_00361561 predicted 430
4 SASI_Hs01_00053069 predicted 469
5 SASI_Hs02_00361562 predicted 347
6 SASI_Hs02_00361563 predicted 396
7 SASI_Hs01_00053070 predicted 635
8 SASI_Hs01_00053072 predicted 416
9 SASI_Hs01_00053075 predicted 316
10 SASI_Hs01_00053077 predicted 459
11 SASI_Hs01_00053071 predicted 912
12 SASI_Hs01_00053073 predicted 721
13 SASI_Hs01_00053074 predicted 664
14 SASI_Hs01_00053076 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043947 predicted 485
2 SASI_Rn01_00043948 predicted 446
3 SASI_Rn01_00043949 predicted 313
4 SASI_Rn01_00043950 predicted 416
5 SASI_Rn01_00043951 predicted 353
6 SASI_Rn01_00043952 predicted 441
7 SASI_Rn01_00043953 predicted 491
8 SASI_Rn01_00043955 predicted 431
9 SASI_Rn02_00201434 predicted 458
10 SASI_Rn02_00201435 predicted 482
11 SASI_Rn01_00043954 predicted 566
12 SASI_Rn01_00043956 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340520 predicted 493
2 SASI_Mm01_00087822 predicted 875
3 SASI_Mm01_00087823 predicted 927
4 SASI_Mm01_00087825 predicted 608
5 SASI_Mm01_00087826 predicted 1081
6 SASI_Mm01_00087827 predicted 818
7 SASI_Mm01_00087828 predicted 506
8 SASI_Mm01_00087829 predicted 1075
9 SASI_Mm01_00087830 predicted 462
10 SASI_Mm01_00087831 predicted 1015
11 SASI_Mm01_00087824 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052864
TIFA MISSION shRNA Bacterial Glycerol Stock
TRAF-interacting protein with forkhead-associated domain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-466s1c1
Sequence:CCGGGACAAACAGGTTTCCCGAGTTCTCGAGAACTCGGGAAACCTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-663s1c1
Sequence:CCGGGAAGGAAGATGGCGAGTCATTCTCGAGAATGACTCGCCATCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-353s1c1
Sequence:CCGGGCCAGTTGCAGTGTGGAATATCTCGAGATATTCCACACTGCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052864.2-2791s1c1
Sequence:CCGGGCGTTCTATGAGTGAAGTGTACTCGAGTACACTTCACTCATAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-639s1c1
Sequence:CCGGCGGAGAGTATCAGTTTCTGATCTCGAGATCAGAAACTGATACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052864.2-1479s1c1
Sequence:CCGGCCACTGTGTTAAGTTTAGGATCTCGAGATCCTAAACTTAACACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-433s1c1
Sequence:CCGGCGAAATTCCAACATCTGTCATCTCGAGATGACAGATGTTGGAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-418s1c1
Sequence:CCGGGTGGTGAAATTTGGCCGAAATCTCGAGATTTCGGCCAAATTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-715s1c1
Sequence:CCGGCCAAGATCACTCTTGCAAGAACTCGAGTTCTTGCAAGAGTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-328s1c1
Sequence:CCGGCTCCAGATGACGGTTTACCATCTCGAGATGGTAAACCGTCATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052864
TIFA MISSION shRNA shRNA Plasmid DNA
TRAF-interacting protein with forkhead-associated domain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-466s1c1
Sequence:CCGGGACAAACAGGTTTCCCGAGTTCTCGAGAACTCGGGAAACCTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-663s1c1
Sequence:CCGGGAAGGAAGATGGCGAGTCATTCTCGAGAATGACTCGCCATCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-353s1c1
Sequence:CCGGGCCAGTTGCAGTGTGGAATATCTCGAGATATTCCACACTGCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052864.2-2791s1c1
Sequence:CCGGGCGTTCTATGAGTGAAGTGTACTCGAGTACACTTCACTCATAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-639s1c1
Sequence:CCGGCGGAGAGTATCAGTTTCTGATCTCGAGATCAGAAACTGATACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052864.2-1479s1c1
Sequence:CCGGCCACTGTGTTAAGTTTAGGATCTCGAGATCCTAAACTTAACACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-433s1c1
Sequence:CCGGCGAAATTCCAACATCTGTCATCTCGAGATGACAGATGTTGGAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-418s1c1
Sequence:CCGGGTGGTGAAATTTGGCCGAAATCTCGAGATTTCGGCCAAATTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-715s1c1
Sequence:CCGGCCAAGATCACTCTTGCAAGAACTCGAGTTCTTGCAAGAGTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-328s1c1
Sequence:CCGGCTCCAGATGACGGTTTACCATCTCGAGATGGTAAACCGTCATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052864
TIFA MISSION shRNA Lentiviral Transduction Particles
TRAF-interacting protein with forkhead-associated domain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-466s1c1
Sequence:CCGGGACAAACAGGTTTCCCGAGTTCTCGAGAACTCGGGAAACCTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-663s1c1
Sequence:CCGGGAAGGAAGATGGCGAGTCATTCTCGAGAATGACTCGCCATCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-353s1c1
Sequence:CCGGGCCAGTTGCAGTGTGGAATATCTCGAGATATTCCACACTGCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052864.2-2791s1c1
Sequence:CCGGGCGTTCTATGAGTGAAGTGTACTCGAGTACACTTCACTCATAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-639s1c1
Sequence:CCGGCGGAGAGTATCAGTTTCTGATCTCGAGATCAGAAACTGATACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052864.2-1479s1c1
Sequence:CCGGCCACTGTGTTAAGTTTAGGATCTCGAGATCCTAAACTTAACACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-433s1c1
Sequence:CCGGCGAAATTCCAACATCTGTCATCTCGAGATGACAGATGTTGGAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-418s1c1
Sequence:CCGGGTGGTGAAATTTGGCCGAAATCTCGAGATTTCGGCCAAATTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052864.2-715s1c1
Sequence:CCGGCCAAGATCACTCTTGCAAGAACTCGAGTTCTTGCAAGAGTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052864.2-328s1c1
Sequence:CCGGCTCCAGATGACGGTTTACCATCTCGAGATGGTAAACCGTCATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145133
VALIDATED
TIFA MISSION shRNA Bacterial Glycerol Stock
TRAF-interacting protein with forkhead-associated domain
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-395s1c1
Sequence:CCGGGCCAACAAAGTGGGATATTTACTCGAGTAAATATCCCACTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-563s1c1
Sequence:CCGGGCTCCGTTCTCTCGTTTGAAACTCGAGTTTCAAACGAGAGAACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145133.2-566s1c1
Sequence:CCGGCCGTTCTCTCGTTTGAAATAACTCGAGTTATTTCAAACGAGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-1563s1c1
Sequence:CCGGCCAGTTCCTTAGTTGCTTCTTCTCGAGAAGAAGCAACTAAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145133.2-448s1c1
Sequence:CCGGCCTTCCATTGAAGTGGTGAAACTCGAGTTTCACCACTTCAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145133.3-816s1c1
Sequence:CCGGGATGGGATGTATTCTTCATACCTCGAGGTATGAAGAATACATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145133.3-1033s1c1
Sequence:CCGGCTGTGTTAATCATCAACTTAGCTCGAGCTAAGTTGATGATTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145133
VALIDATED
TIFA MISSION shRNA shRNA Plasmid DNA
TRAF-interacting protein with forkhead-associated domain
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-395s1c1
Sequence:CCGGGCCAACAAAGTGGGATATTTACTCGAGTAAATATCCCACTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-563s1c1
Sequence:CCGGGCTCCGTTCTCTCGTTTGAAACTCGAGTTTCAAACGAGAGAACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145133.2-566s1c1
Sequence:CCGGCCGTTCTCTCGTTTGAAATAACTCGAGTTATTTCAAACGAGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-1563s1c1
Sequence:CCGGCCAGTTCCTTAGTTGCTTCTTCTCGAGAAGAAGCAACTAAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145133.2-448s1c1
Sequence:CCGGCCTTCCATTGAAGTGGTGAAACTCGAGTTTCACCACTTCAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145133.3-816s1c1
Sequence:CCGGGATGGGATGTATTCTTCATACCTCGAGGTATGAAGAATACATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145133.3-1033s1c1
Sequence:CCGGCTGTGTTAATCATCAACTTAGCTCGAGCTAAGTTGATGATTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145133
VALIDATED
TIFA MISSION shRNA Lentiviral Transduction Particles
TRAF-interacting protein with forkhead-associated domain
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-395s1c1
Sequence:CCGGGCCAACAAAGTGGGATATTTACTCGAGTAAATATCCCACTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-563s1c1
Sequence:CCGGGCTCCGTTCTCTCGTTTGAAACTCGAGTTTCAAACGAGAGAACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145133.2-566s1c1
Sequence:CCGGCCGTTCTCTCGTTTGAAATAACTCGAGTTATTTCAAACGAGAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145133.2-1563s1c1
Sequence:CCGGCCAGTTCCTTAGTTGCTTCTTCTCGAGAAGAAGCAACTAAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145133.2-448s1c1
Sequence:CCGGCCTTCCATTGAAGTGGTGAAACTCGAGTTTCACCACTTCAATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145133.3-816s1c1
Sequence:CCGGGATGGGATGTATTCTTCATACCTCGAGGTATGAAGAATACATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145133.3-1033s1c1
Sequence:CCGGCTGTGTTAATCATCAACTTAGCTCGAGCTAAGTTGATGATTAACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks