EMAIL THIS PAGE TO A FRIEND

TIFAB

TRAF-interacting protein with forkhead-associated domain, family member B

UniProtKB ID: Q6ZNK6, Q5H8A9
Gene ID:
Human(497189) Summary: TIFAB associates with TIFA (MIM 609028) and inhibits TIFA-mediated activation of NF-kappa-B (NFKB1; MIM 164011) (Matsumura et al., 2004 [PubMed 15047173]
Mouse(212937) TRAF-interacting protein with forkhead-associated domain, family member B
Rat(364674) TRAF-interacting protein with forkhead-associated domain, family member B
naked mole-rat(101713741) TRAF-interacting protein with forkhead-associated domain, family member B
cow(524523) TRAF-interacting protein with forkhead-associated domain, family member B
dog(481515) TRAF-interacting protein with forkhead-associated domain, family member B
domestic cat(101087445) TRAF-interacting protein with forkhead-associated domain, family member B
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017831 MISSION® esiRNA esiRNA targeting mouse Tifab (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099221 Rosetta Predictions human pricing
XM_928467 Rosetta Predictions human pricing
NM_001025029 Rosetta Predictions rat pricing
NM_145976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320229 predicted 530
2 SASI_Hs02_00320230 predicted 1042
3 SASI_Hs02_00320231 predicted 964
4 SASI_Hs02_00320232 predicted 1042
5 SASI_Hs02_00320233 predicted 627
6 SASI_Hs02_00320234 predicted 829
7 SASI_Hs02_00320235 predicted 842
8 SASI_Hs02_00320236 predicted 449
9 SASI_Hs02_00320237 predicted 869
10 SASI_Hs02_00320238 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277983 predicted 1204
2 SASI_Hs01_00277984 predicted 1152
3 SASI_Hs01_00277985 predicted 1191
4 SASI_Hs01_00277986 predicted 1164
5 SASI_Hs01_00277987 predicted 1204
6 SASI_Hs01_00277988 predicted 1130
7 SASI_Hs01_00277989 predicted 1207
8 SASI_Hs01_00277990 predicted 1204
9 SASI_Hs01_00277991 predicted 1122
10 SASI_Hs01_00277992 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061479 predicted 1056
2 SASI_Rn01_00061480 predicted 999
3 SASI_Rn02_00202942 predicted 440
4 SASI_Rn01_00061481 predicted 1039
5 SASI_Rn01_00061482 predicted 934
6 SASI_Rn01_00061483 predicted 958
7 SASI_Rn01_00061484 predicted 1057
8 SASI_Rn02_00202943 predicted 530
9 SASI_Rn01_00061485 predicted 588
10 SASI_Rn01_00061486 predicted 722
11 SASI_Rn01_00061487 predicted 959
12 SASI_Rn01_00061488 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171299 predicted 569
2 SASI_Mm01_00171300 predicted 495
3 SASI_Mm01_00171301 predicted 652
4 SASI_Mm01_00171302 predicted 706
5 SASI_Mm01_00171303 predicted 436
6 SASI_Mm01_00171304 predicted 523
7 SASI_Mm01_00171306 predicted 669
8 SASI_Mm01_00171307 predicted 921
9 SASI_Mm01_00171308 predicted 719
10 SASI_Mm02_00341477 predicted 710
11 SASI_Mm01_00171305 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099221
TIFAB MISSION shRNA Bacterial Glycerol Stock
TRAF-interacting protein with forkhead-associated domain, family member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-624s21c1
Sequence:CCGGGGCTGAGGAAACTGACGAATGCTCGAGCATTCGTCAGTTTCCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-506s21c1
Sequence:CCGGTCAACAGGGTCTCCTTCTCAGCTCGAGCTGAGAAGGAGACCCTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-279s21c1
Sequence:CCGGACCACGGCTGCAGCATGATACCTCGAGGTATCATGCTGCAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099221.1-993s21c1
Sequence:CCGGTGTAATGGGAACATCATATACCTCGAGGTATATGATGTTCCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-532s21c1
Sequence:CCGGCAGATGCTGGTTCGCGTAGAACTCGAGTTCTACGCGAACCAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-576s21c1
Sequence:CCGGTGTCTGCTATTTCCATGTCAGCTCGAGCTGACATGGAAATAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-257s21c1
Sequence:CCGGCATCTGCCTTTGCCAATGTCCCTCGAGGGACATTGGCAAAGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099221
TIFAB MISSION shRNA shRNA Plasmid DNA
TRAF-interacting protein with forkhead-associated domain, family member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-624s21c1
Sequence:CCGGGGCTGAGGAAACTGACGAATGCTCGAGCATTCGTCAGTTTCCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-506s21c1
Sequence:CCGGTCAACAGGGTCTCCTTCTCAGCTCGAGCTGAGAAGGAGACCCTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-279s21c1
Sequence:CCGGACCACGGCTGCAGCATGATACCTCGAGGTATCATGCTGCAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099221.1-993s21c1
Sequence:CCGGTGTAATGGGAACATCATATACCTCGAGGTATATGATGTTCCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-532s21c1
Sequence:CCGGCAGATGCTGGTTCGCGTAGAACTCGAGTTCTACGCGAACCAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-576s21c1
Sequence:CCGGTGTCTGCTATTTCCATGTCAGCTCGAGCTGACATGGAAATAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-257s21c1
Sequence:CCGGCATCTGCCTTTGCCAATGTCCCTCGAGGGACATTGGCAAAGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099221
TIFAB MISSION shRNA Lentiviral Transduction Particles
TRAF-interacting protein with forkhead-associated domain, family member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-624s21c1
Sequence:CCGGGGCTGAGGAAACTGACGAATGCTCGAGCATTCGTCAGTTTCCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-506s21c1
Sequence:CCGGTCAACAGGGTCTCCTTCTCAGCTCGAGCTGAGAAGGAGACCCTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-279s21c1
Sequence:CCGGACCACGGCTGCAGCATGATACCTCGAGGTATCATGCTGCAGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099221.1-993s21c1
Sequence:CCGGTGTAATGGGAACATCATATACCTCGAGGTATATGATGTTCCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-532s21c1
Sequence:CCGGCAGATGCTGGTTCGCGTAGAACTCGAGTTCTACGCGAACCAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-576s21c1
Sequence:CCGGTGTCTGCTATTTCCATGTCAGCTCGAGCTGACATGGAAATAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099221.1-257s21c1
Sequence:CCGGCATCTGCCTTTGCCAATGTCCCTCGAGGGACATTGGCAAAGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145976
TIFAB MISSION shRNA Bacterial Glycerol Stock
TRAF-interacting protein with forkhead-associated domain, family member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-577s1c1
Sequence:CCGGCACAGTTGTCTCGCTACCATTCTCGAGAATGGTAGCGAGACAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-719s1c1
Sequence:CCGGCTTGGGCACCATCAACAGAATCTCGAGATTCTGTTGATGGTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-796s1c1
Sequence:CCGGCCTTTGTCTGCTACTTCCATCCTCGAGGATGGAAGTAGCAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-727s1c1
Sequence:CCGGCCATCAACAGAATCTCCTTCTCTCGAGAGAAGGAGATTCTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145976
TIFAB MISSION shRNA shRNA Plasmid DNA
TRAF-interacting protein with forkhead-associated domain, family member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-577s1c1
Sequence:CCGGCACAGTTGTCTCGCTACCATTCTCGAGAATGGTAGCGAGACAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-719s1c1
Sequence:CCGGCTTGGGCACCATCAACAGAATCTCGAGATTCTGTTGATGGTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-796s1c1
Sequence:CCGGCCTTTGTCTGCTACTTCCATCCTCGAGGATGGAAGTAGCAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-727s1c1
Sequence:CCGGCCATCAACAGAATCTCCTTCTCTCGAGAGAAGGAGATTCTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145976
TIFAB MISSION shRNA Lentiviral Transduction Particles
TRAF-interacting protein with forkhead-associated domain, family member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-577s1c1
Sequence:CCGGCACAGTTGTCTCGCTACCATTCTCGAGAATGGTAGCGAGACAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-719s1c1
Sequence:CCGGCTTGGGCACCATCAACAGAATCTCGAGATTCTGTTGATGGTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-796s1c1
Sequence:CCGGCCTTTGTCTGCTACTTCCATCCTCGAGGATGGAAGTAGCAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145976.2-727s1c1
Sequence:CCGGCCATCAACAGAATCTCCTTCTCTCGAGAGAAGGAGATTCTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks