EMAIL THIS PAGE TO A FRIEND

TIGD1

tigger transposable element derived 1

Synonyms: EEYORE
Species: Human TIGD1(200765)
UniProtKB ID: Q96MW7, Q6P4D2, Q6PIF9
Gene ID:
Human(200765) Summary: The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145702
TIGD1 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-2027s1c1
Sequence:CCGGGCGCAAAGAAAGTGGTTTCTTCTCGAGAAGAAACCACTTTCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-764s1c1
Sequence:CCGGCGGCAAACAGTTAGCCAAGTTCTCGAGAACTTGGCTAACTGTTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-1603s1c1
Sequence:CCGGGCCTGCTAACACAACATCCATCTCGAGATGGATGTTGTGTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-920s1c1
Sequence:CCGGCGCAACATTCCCTTAAGCCAACTCGAGTTGGCTTAAGGGAATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-2215s1c1
Sequence:CCGGCGCATGCTACAGAGAAATCTTCTCGAGAAGATTTCTCTGTAGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-1604s1c1
Sequence:CCGGCCTGCTAACACAACATCCATTCTCGAGAATGGATGTTGTGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-2029s1c1
Sequence:CCGGGCAAAGAAAGTGGTTTCTTGACTCGAGTCAAGAAACCACTTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-840s1c1
Sequence:CCGGCACGAATGATAAGAAAGCGAACTCGAGTTCGCTTTCTTATCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-668s1c1
Sequence:CCGGCGCACATCTCTCACTTTAAATCTCGAGATTTAAAGTGAGAGATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145702
TIGD1 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-2027s1c1
Sequence:CCGGGCGCAAAGAAAGTGGTTTCTTCTCGAGAAGAAACCACTTTCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-764s1c1
Sequence:CCGGCGGCAAACAGTTAGCCAAGTTCTCGAGAACTTGGCTAACTGTTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-1603s1c1
Sequence:CCGGGCCTGCTAACACAACATCCATCTCGAGATGGATGTTGTGTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-920s1c1
Sequence:CCGGCGCAACATTCCCTTAAGCCAACTCGAGTTGGCTTAAGGGAATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-2215s1c1
Sequence:CCGGCGCATGCTACAGAGAAATCTTCTCGAGAAGATTTCTCTGTAGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-1604s1c1
Sequence:CCGGCCTGCTAACACAACATCCATTCTCGAGAATGGATGTTGTGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-2029s1c1
Sequence:CCGGGCAAAGAAAGTGGTTTCTTGACTCGAGTCAAGAAACCACTTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-840s1c1
Sequence:CCGGCACGAATGATAAGAAAGCGAACTCGAGTTCGCTTTCTTATCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-668s1c1
Sequence:CCGGCGCACATCTCTCACTTTAAATCTCGAGATTTAAAGTGAGAGATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145702
TIGD1 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-2027s1c1
Sequence:CCGGGCGCAAAGAAAGTGGTTTCTTCTCGAGAAGAAACCACTTTCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-764s1c1
Sequence:CCGGCGGCAAACAGTTAGCCAAGTTCTCGAGAACTTGGCTAACTGTTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-1603s1c1
Sequence:CCGGGCCTGCTAACACAACATCCATCTCGAGATGGATGTTGTGTTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-920s1c1
Sequence:CCGGCGCAACATTCCCTTAAGCCAACTCGAGTTGGCTTAAGGGAATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-2215s1c1
Sequence:CCGGCGCATGCTACAGAGAAATCTTCTCGAGAAGATTTCTCTGTAGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-1604s1c1
Sequence:CCGGCCTGCTAACACAACATCCATTCTCGAGAATGGATGTTGTGTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145702.1-2029s1c1
Sequence:CCGGGCAAAGAAAGTGGTTTCTTGACTCGAGTCAAGAAACCACTTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-840s1c1
Sequence:CCGGCACGAATGATAAGAAAGCGAACTCGAGTTCGCTTTCTTATCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145702.1-668s1c1
Sequence:CCGGCGCACATCTCTCACTTTAAATCTCGAGATTTAAAGTGAGAGATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks