EMAIL THIS PAGE TO A FRIEND

TIGD2

tigger transposable element derived 2

UniProtKB ID: Q4W5G0
Gene ID:
Human(166815) Summary: The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Mouse(68140) tigger transposable element derived 2
Rat(500150) tigger transposable element derived 2
domestic cat(101092358) tigger transposable element derived 2
cow(101903701) tigger transposable element derived 2
sheep(101118103) tigger transposable element derived 2
cow(532427) tigger transposable element derived 2
naked mole-rat(101698967) tigger transposable element derived 2
domestic guinea pig(100724835) tigger transposable element derived 2
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145715 Rosetta Predictions human pricing
XM_575502 Rosetta Predictions rat pricing
NM_001081145 Rosetta Predictions mouse pricing
XM_144820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040369 predicted 629
2 SASI_Hs01_00040370 predicted 1564
3 SASI_Hs02_00365317 predicted 350
4 SASI_Hs01_00040371 predicted 1586
5 SASI_Hs01_00040372 predicted 1557
6 SASI_Hs01_00040373 predicted 318
7 SASI_Hs01_00040374 predicted 682
8 SASI_Hs01_00040375 predicted 324
9 SASI_Hs01_00040377 predicted 387
10 SASI_Hs01_00040378 predicted 260
11 SASI_Hs01_00040376 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153850 predicted 285
2 SASI_Rn01_00153851 predicted 287
3 SASI_Rn01_00153852 predicted 288
4 SASI_Rn01_00153853 predicted 283
5 SASI_Rn01_00153854 predicted 213
6 SASI_Rn01_00153855 predicted 259
7 SASI_Rn01_00153856 predicted 231
8 SASI_Rn01_00153857 predicted 221
9 SASI_Rn01_00153858 predicted 255
10 SASI_Rn01_00153859 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295621 predicted 2107
2 SASI_Mm02_00295622 predicted 2773
3 SASI_Mm02_00295623 predicted 2044
4 SASI_Mm02_00295624 predicted 2333
5 SASI_Mm02_00295625 predicted 2735
6 SASI_Mm02_00295626 predicted 2096
7 SASI_Mm02_00295627 predicted 2406
8 SASI_Mm02_00295628 predicted 2200
9 SASI_Mm02_00295629 predicted 2538
10 SASI_Mm02_00295630 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205556 predicted 2105
2 SASI_Mm01_00205557 predicted 2781
3 SASI_Mm01_00205558 predicted 2052
4 SASI_Mm01_00205559 predicted 2347
5 SASI_Mm01_00205560 predicted 2738
6 SASI_Mm01_00205561 predicted 2095
7 SASI_Mm01_00205562 predicted 2419
8 SASI_Mm01_00205563 predicted 2208
9 SASI_Mm01_00205564 predicted 2547
10 SASI_Mm01_00205565 predicted 2077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145715
VALIDATED
TIGD2 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145715.1-343s1c1
Sequence:CCGGCCAGTGGAGTATCCAAACGTACTCGAGTACGTTTGGATACTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145715.1-1783s1c1
Sequence:CCGGGCAGTGAAACTTTGCTTGTTTCTCGAGAAACAAGCAAAGTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145715.1-773s1c1
Sequence:CCGGCAGAGAGAGAATCATCATTATCTCGAGATAATGATGATTCTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1573s1c1
Sequence:CCGGCAGAGAAGCATATTAGCCATACTCGAGTATGGCTAATATGCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145715.1-1857s1c1
Sequence:CCGGGATGTCAGTTTGGATTACTTACTCGAGTAAGTAATCCAAACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1069s1c1
Sequence:CCGGGTTCAGATGATGGCAGAATAACTCGAGTTATTCTGCCATCATCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1378s1c1
Sequence:CCGGCAGCTAATTTAGCAACAGTTTCTCGAGAAACTGTTGCTAAATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-1573s21c1
Sequence:CCGGCAGAGAAGCATATTAGCCATACTCGAGTATGGCTAATATGCTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_145715.2-1239s21c1
Sequence:CCGGACAGTGTTGGATGCAATTTATCTCGAGATAAATTGCATCCAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-272s21c1
Sequence:CCGGTGAATCCACAGTTCGTGATATCTCGAGATATCACGAACTGTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-1069s21c1
Sequence:CCGGGTTCAGATGATGGCAGAATAACTCGAGTTATTCTGCCATCATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145715
VALIDATED
TIGD2 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145715.1-343s1c1
Sequence:CCGGCCAGTGGAGTATCCAAACGTACTCGAGTACGTTTGGATACTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145715.1-1783s1c1
Sequence:CCGGGCAGTGAAACTTTGCTTGTTTCTCGAGAAACAAGCAAAGTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145715.1-773s1c1
Sequence:CCGGCAGAGAGAGAATCATCATTATCTCGAGATAATGATGATTCTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1573s1c1
Sequence:CCGGCAGAGAAGCATATTAGCCATACTCGAGTATGGCTAATATGCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145715.1-1857s1c1
Sequence:CCGGGATGTCAGTTTGGATTACTTACTCGAGTAAGTAATCCAAACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1069s1c1
Sequence:CCGGGTTCAGATGATGGCAGAATAACTCGAGTTATTCTGCCATCATCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1378s1c1
Sequence:CCGGCAGCTAATTTAGCAACAGTTTCTCGAGAAACTGTTGCTAAATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-1573s21c1
Sequence:CCGGCAGAGAAGCATATTAGCCATACTCGAGTATGGCTAATATGCTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_145715.2-1239s21c1
Sequence:CCGGACAGTGTTGGATGCAATTTATCTCGAGATAAATTGCATCCAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-272s21c1
Sequence:CCGGTGAATCCACAGTTCGTGATATCTCGAGATATCACGAACTGTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-1069s21c1
Sequence:CCGGGTTCAGATGATGGCAGAATAACTCGAGTTATTCTGCCATCATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145715
VALIDATED
TIGD2 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145715.1-343s1c1
Sequence:CCGGCCAGTGGAGTATCCAAACGTACTCGAGTACGTTTGGATACTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145715.1-1783s1c1
Sequence:CCGGGCAGTGAAACTTTGCTTGTTTCTCGAGAAACAAGCAAAGTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145715.1-773s1c1
Sequence:CCGGCAGAGAGAGAATCATCATTATCTCGAGATAATGATGATTCTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1573s1c1
Sequence:CCGGCAGAGAAGCATATTAGCCATACTCGAGTATGGCTAATATGCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145715.1-1857s1c1
Sequence:CCGGGATGTCAGTTTGGATTACTTACTCGAGTAAGTAATCCAAACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1069s1c1
Sequence:CCGGGTTCAGATGATGGCAGAATAACTCGAGTTATTCTGCCATCATCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145715.1-1378s1c1
Sequence:CCGGCAGCTAATTTAGCAACAGTTTCTCGAGAAACTGTTGCTAAATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-1573s21c1
Sequence:CCGGCAGAGAAGCATATTAGCCATACTCGAGTATGGCTAATATGCTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_145715.2-1239s21c1
Sequence:CCGGACAGTGTTGGATGCAATTTATCTCGAGATAAATTGCATCCAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-272s21c1
Sequence:CCGGTGAATCCACAGTTCGTGATATCTCGAGATATCACGAACTGTGGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145715.2-1069s21c1
Sequence:CCGGGTTCAGATGATGGCAGAATAACTCGAGTTATTCTGCCATCATCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081145
VALIDATED
TIGD2 MISSION shRNA Bacterial Glycerol Stock
tigger transposable element derived 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2705s21c1
Sequence:GTACCGGTCCCTTCTGTTGCTATGTATTCTCGAGAATACATAGCAACAGAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2642s21c1
Sequence:CCGGCGGAGGCTTCGGACCATTATACTCGAGTATAATGGTCCGAAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2533s21c1
Sequence:CCGGGAATCCAGAGAAGCATATTAGCTCGAGCTAATATGCTTCTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081145.1-2072s21c1
Sequence:CCGGCCAAACGTCACAAGTCTAATTCTCGAGAATTAGACTTGTGACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081145.1-1625s21c1
Sequence:CCGGCTCCTACCAGAACAGATTTATCTCGAGATAAATCTGTTCTGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081145
VALIDATED
TIGD2 MISSION shRNA shRNA Plasmid DNA
tigger transposable element derived 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2705s21c1
Sequence:GTACCGGTCCCTTCTGTTGCTATGTATTCTCGAGAATACATAGCAACAGAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2642s21c1
Sequence:CCGGCGGAGGCTTCGGACCATTATACTCGAGTATAATGGTCCGAAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2533s21c1
Sequence:CCGGGAATCCAGAGAAGCATATTAGCTCGAGCTAATATGCTTCTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081145.1-2072s21c1
Sequence:CCGGCCAAACGTCACAAGTCTAATTCTCGAGAATTAGACTTGTGACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081145.1-1625s21c1
Sequence:CCGGCTCCTACCAGAACAGATTTATCTCGAGATAAATCTGTTCTGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081145
VALIDATED
TIGD2 MISSION shRNA Lentiviral Transduction Particles
tigger transposable element derived 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2705s21c1
Sequence:GTACCGGTCCCTTCTGTTGCTATGTATTCTCGAGAATACATAGCAACAGAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2642s21c1
Sequence:CCGGCGGAGGCTTCGGACCATTATACTCGAGTATAATGGTCCGAAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081145.1-2533s21c1
Sequence:CCGGGAATCCAGAGAAGCATATTAGCTCGAGCTAATATGCTTCTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081145.1-2072s21c1
Sequence:CCGGCCAAACGTCACAAGTCTAATTCTCGAGAATTAGACTTGTGACGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081145.1-1625s21c1
Sequence:CCGGCTCCTACCAGAACAGATTTATCTCGAGATAAATCTGTTCTGGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks